Identification and characterization of microRNAs in Clonorchis sinensis of human health significance

BMC Genomics

Table 2 Sequences of the six novel miRNAs identified in Clonorchis sinensis and their location within the published Schistosoma japonicum genome

miRNA	Sequence (5'-3')	Size	Loci^a	Count^b	ΔG^c	Express level^d
cis-mir-001	UGGAAAAGAGAUACGGCUGCU	21	14	12	-23.1	0.30 ± 0.07
cis-mir-002	CUGGUCAUCAUCAUCAUCAUA	21	1	5	-23.0	0.10 ± 0.02
cis-mir-006	UAUCACAGCCGUGCUUAAGGGC	22	1	108	-28.4	0.001 ± 0.00
cis-mir-010	UAUUAUGCAACGUUUCACUCU	21	1	8	-37.9	0.02 ± 0.01
cis-mir-018	GAGAGAUUUGUGGAUACCUU	20	2	13	-21.9	0.0005 ± 0.00
cis-mir-019	UAGAGGAAUUGACGGAAGGGCA	22	1	5	-19.9	67.32 ± 12.87

^a Location number of the miRNA sequence with the published genome sequence of S. japonicum of LSBI, Shanghai.
^b The number of each miRNA appeared in the clean reads.
^c ΔG means the energy of pre-miRNA hairpin, kcal/mol.
^d The expression levels of the six novel miRNA relative to actin gene, and the data represent the means and standard deviation (SD) for triplicate reactions independently.

ISSN: 1471-2164