Skip to main content

Table 7 Primers used for quantitative RT-PCR analysis of unigene locations (ULs)

From: Gene discovery for the bark beetle-vectored fungal tree pathogen Grosmannia clavigera

Target UL Primer name 5'-3' sequence
3230 R1718-F1 GTG TCC TCC ACC TTC CTC ACC
  R1718-R1 CGT GAC TCC CTT GAC TTC TGG G
Gc_00052 Gc_0052-F1 GCT CTC TCT TTT GCC GGC GGA
  Gc_0052-R1 GAG CCG GCC AGC GTT GAG TAA
Gc_00102 Gc_00102-F1 TCG GAC GGA CTG CAA ACG CG
  Gc_00102-R1 CGA GCC CCA GAA AAG GAC GAC
3233 R1719-F1 CTC AGC AAC GGT CCA ACC TC
  R1719-R1 GTG CTT CTT CCA CTT GCG GG
3234 F1718-F3 GAGCTGCTGACGCTCGATAA
  F1718-R3 ACCTGACTGCTGTCGTCCAT