From: Identification and characterization of microRNAs and endogenous siRNAs in Schistosoma japonicum
MicroRNA Name | Mature Arm | miR*a | Most abundant sequence | Len | Expressionc (TPMb) | ||
---|---|---|---|---|---|---|---|
 |  |  |  |  | AduMix | schistosomulum | P-valued |
Sja-Novel-16 | 5' | Y | UGAUAUGUAUGGGUUACUUGGU | 22 | 16802 | 1405 | 0 |
Sja-Novel-137 | 5' | Y | AGAGGUAGUGAUUCAUAUGACU | 22 | 8800 | 3484 | 0 |
Sja-Novel-110 | 3' | Y | UGAGAUCGCGAUUAAAGCU | 19 | 6477 | 6 | 0 |
Sja-Novel-148 | 5' | Y | UCCCUGAGACUGAUAAUUGCU | 21 | 4888 | 909 | 0 |
Sja-Novel-70 | 5' | Y | UCAGCUGUGUUCAUGUCUUCGA | 22 | 843 | 1 | 0 |
Sja-Novel-168 | 3' | Y | UAUUAUGCAACGUUUCACUCU | 21 | 164 | 439 | 0 |
Sja-Novel-166 | 3' | Y | UGAGAUUCAAUUACUUCAACU | 21 | 345 | 8 | 0 |
Sja-Novel-37 | 3' | Y | UAUUGCACUUACCUUCGCCUUG | 22 | 169 | 57 | 0 |
Sja-Novel-173 | 5' | N | CAGACUCACAGAAAUGCUAA | 20 | 31 | 29 | 0.159 |
Sja-Novel-245 | 5' | Y | UCUUUGGUUAUCAAGCAAUAUGA | 23 | 46 | 10 | 0 |
Sja-Novel-239 | 3' | N | CUGAGAAUCUGUUGGAUGUU | 20 | 23 | 27 | 0.001 |
Sja-Novel-255 | 3' | N | GGCGGAUAGGGAGUUGGCGU | 20 | 35 | 13 | 0 |
Sja-Novel-120 | 3' | N | ACGAGGGCGCUGCAGGGGUUUU | 22 | 24 | 2 | 0 |
Sja-Novel-121 | 3' | N | GCCAAGACGCGUCACGACAUUU | 22 | 20 | 4 | 0 |
Sja-Novel-35 | 5' | N | UGGACACAGUAGCCUAGUGGUU | 22 | 16 | 7 | 0.0008 |
Sja-Novel-36 | 3' | Y | UAUCACAGUCCAAGCUUUGGUAA | 23 | 10 | 13 | 0.0054 |
Sja-Novel-147 | 5' | N | UGGCAAGAUUACGGCGAAGCU | 21 | 18 | 4 | 0 |
Sja-Novel-128 | 5' | N | AAGCGUUCGGACGUUGGCAC | 20 | 19 | 1 | 0 |
Sja-Novel-203 | 5' | N | AGUUAUAUUUAAGUUGGAUUUU | 22 | 8 | 12 | 0.0012 |
Sja-Novel-21 | 5' | Y | AAGUUCUGAUAGAUGUUGCA | 20 | 16 | 4 | 0 |