Skip to main content

Table 2 Top 20 novel abundantly-expressed miRNAs in S. japonicum

From: Identification and characterization of microRNAs and endogenous siRNAs in Schistosoma japonicum

MicroRNA Name Mature Arm miR*a Most abundant sequence Len Expressionc (TPMb)
      AduMix schistosomulum P-valued
Sja-Novel-16 5' Y UGAUAUGUAUGGGUUACUUGGU 22 16802 1405 0
Sja-Novel-137 5' Y AGAGGUAGUGAUUCAUAUGACU 22 8800 3484 0
Sja-Novel-110 3' Y UGAGAUCGCGAUUAAAGCU 19 6477 6 0
Sja-Novel-148 5' Y UCCCUGAGACUGAUAAUUGCU 21 4888 909 0
Sja-Novel-70 5' Y UCAGCUGUGUUCAUGUCUUCGA 22 843 1 0
Sja-Novel-168 3' Y UAUUAUGCAACGUUUCACUCU 21 164 439 0
Sja-Novel-166 3' Y UGAGAUUCAAUUACUUCAACU 21 345 8 0
Sja-Novel-37 3' Y UAUUGCACUUACCUUCGCCUUG 22 169 57 0
Sja-Novel-173 5' N CAGACUCACAGAAAUGCUAA 20 31 29 0.159
Sja-Novel-245 5' Y UCUUUGGUUAUCAAGCAAUAUGA 23 46 10 0
Sja-Novel-239 3' N CUGAGAAUCUGUUGGAUGUU 20 23 27 0.001
Sja-Novel-255 3' N GGCGGAUAGGGAGUUGGCGU 20 35 13 0
Sja-Novel-120 3' N ACGAGGGCGCUGCAGGGGUUUU 22 24 2 0
Sja-Novel-121 3' N GCCAAGACGCGUCACGACAUUU 22 20 4 0
Sja-Novel-35 5' N UGGACACAGUAGCCUAGUGGUU 22 16 7 0.0008
Sja-Novel-36 3' Y UAUCACAGUCCAAGCUUUGGUAA 23 10 13 0.0054
Sja-Novel-147 5' N UGGCAAGAUUACGGCGAAGCU 21 18 4 0
Sja-Novel-128 5' N AAGCGUUCGGACGUUGGCAC 20 19 1 0
Sja-Novel-203 5' N AGUUAUAUUUAAGUUGGAUUUU 22 8 12 0.0012
Sja-Novel-21 5' Y AAGUUCUGAUAGAUGUUGCA 20 16 4 0
  1. aY indicates that the sequences from both strands of a miRNA* species were found, while N means that only the sequence from one strand of a miRNA* was identified.
  2. bThe abundance value of each miRNA was normalized to "transcripts per million (TPM)". If the value after normalization was less than 1, the normalized value was set as 1.
  3. cThe expression of miRNA was the sum of the total counts of unique reads which was within ±2 nt variations of the mature miRNA on the precursor.
  4. dThe differentially expressed miRNAs were analyzed using general Chi-square tests.
  5. Len means length of miRNAs. Adumix means miRNA of parasites of mixed adult.