Skip to main content

Table 3 Primers for qPCR

From: Response of swine spleen to Streptococcus suis infection revealed by transcription analysis

primer Accession
number
Sequence Product
size
Plau NM_213945 Forward: CGAACTGTGGCTGTCT
Reverse: AGCAGGTTTGCGATGTG
126 bp
S100A9 a BI402402 Forward: CCAGGATGTGGTTTATGGCTTTC
Reverse: CGGACCAAATGTCGCAGA
186 bp
S100A12 a CB475695 Forward: GGCATTATGACACCCTTATC
Reverse: GTCACCAGGACCACGAAT
169 bp
Hsp70 NM_213766 Forward: AGGCGGAGAAGTACAAAGCG
Reverse: GATGGGGTTACACACCTGCTC
257 bp
Timp1 NM_213857 Forward: CGCCTCGTACCAGCGTTAT
Reverse: GTGGAAGTATCCGCAGACGC
127 bp
SOD2 NM_214127 Forward: TCTGGACAAATCTGAGCCCT
Reverse: GACGGATACAGCGGTCAACTT
119 bp
Il6 b AF493992 Forward: GACAAAGCCACCACCCCTAA
Reverse: CTCGTTCTGTGACTGCAGCTTATC
69 bp
Sele NM_214268 Forward: GGATTTGAACTCATCGGACCT
Reverse: CATTCTGAGGATGGCCGAC
115 bp
Il1b b NM_214055 Forward: GGCCGCCAAGATATAACTGA
Reverse: GGACCTCTGGGTATGGCTTTC
70 bp
Nramp1 U55068 Forward: CGTGGTGACAGGCAAGGACT
Reverse: TAGCCGTGCCGATGACTTC
131 bp
Hsp90 CF180819 Forward: CCCAGTTGATGTCGTTG
Reverse: CCGTCAGGCTTTCGTAT
117 bp
Il8 b NM_213867 Forward: TTCGATGCCAGTGCATAAATA
Reverse: CTGTACAACCTTCTGCACCCA
176 bp
CCL19 BX672579 Forward: GCTAAGCCTCTGGACT
Reverse: AATGAGCAGGTAGCGA
121 bp
Haptocorrin CB472702 Forward: ATTCTCAGGGAGTATTCCGTCT
Reverse: CTTTGGGGACAAGTAGCAGTT
105 bp
Alox15 NM_213931 Forward: ACCGAGGGTTTCCTGTCT
Reverse: AGGTGGTTGGAGGAGTGC
100 bp
TLR2 b NM_213761 Forward:TCACTTGTCTAACTTATCATCCTCTTG
Reverse: TCAGCGAAGGTGTCATTATTGC
162 bp
GAPDH b AF017079 Forward: TGCCAACGTGTCGGTTGT
Reverse: TGTCATCATATTTGGCAGGTTTCT
62 bp
  1. a: primers from reference [43];
  2. b: primers from reference [41].