Skip to main content

Table 3 Primer sequences used in Q-RT PCR

From: Primary transcriptomes of Mycobacterium avium subsp. paratuberculosis reveal proprietary pathways in tissue and macrophages

Gene and direction Sequence
MAP0233c, F ggggtagaaggacaggaagc
MAP0233c, R agttctacgccagcatcgac
MAP0283, F caatcttccgggtctaccac
MAP0283, R gagccggtactgatggtga
MAP0782, F ttcgtgtgcctgtgcaac
MAP0782, R gcgacttcgttggtggtc
MAP1728, F cagccacaaatacgacatcc
MAP1728, R gtgacgaaggctgtttgga
MAP2173c, F gcagggtgcggtagtgac
MAP2173c, R ccgagtatctggtcgaggtg
MAP2488, F gccggttgctcaactacct
MAP2488, R tcaggcagaacgtcaggaa
MAP3698, F ccgtcgatgtaccaccagt
MAP3698, R catcggctccttggtgat
MAP4120c, F ggaaaccaagggatgtcgt
MAP4120c, R acgagacgctgcaagagc
secA, F ggcctgctccttgaggtt
secA, R gcgcaaggtgatctacgc