Skip to main content

Table 1 Primer locations in the exons or flanking untranslated regions1

From: An Sp185/333 gene cluster from the purple sea urchin and putative microsatellite-mediated gene diversification

Primer2 Sequence Strand3 Notes
5' UTR.1 YTDTAGCATCGGAGAKACCT4 S 5' untranslated region of all genes
F2 AAGMGATTWCAATGAACKRCGAG S In the second exon ~500 bp from 5' end of all genes
F5 GGAACYGARGAMGGATCTC S In the second exon ~1.4 kb from the 5' end of most genes
F6 GAAGAAGAAACTGATGCTGCC S In the second exon ~900 bp from the start codon in all genes.
LR1 ATCRTYGCCATYSTGGCYG AS In the first exon ~50 bp from the start codon in all genes.
R5 AAATGGCGGTCCGATGRGTG AS In the second exon ~800 bp from the start codon in most genes
R6 GAGAMGAAGAAACTGATGCTGC AS In the second exon ~900 bp from the start codon in all genes.
R9 CGACATYTTCACCACYTDAAG AS In the second exon ~ 1.5 kb from the 5' end of most genes
3' UTR.1 GTCGCYGAGGTGTAGAATTW AS 3' end of all genes
3' UTF-1 CGTCATAACCGTACCAAAGAC S 3' end of some genes
  1. 1see also [15, 19]
  2. 2F, forward; R, reverse
  3. 3S = sense; AS = antisense
  4. 4D = A, G, or T; K = G or T; Y = C or T; R = A or G; M = A or C