Primer2 | Sequence | Strand3 | Notes |
---|---|---|---|
5' UTR.1 | YTDTAGCATCGGAGAKACCT4 | S | 5' untranslated region of all genes |
F2 | AAGMGATTWCAATGAACKRCGAG | S | In the second exon ~500 bp from 5' end of all genes |
F5 | GGAACYGARGAMGGATCTC | S | In the second exon ~1.4 kb from the 5' end of most genes |
F6 | GAAGAAGAAACTGATGCTGCC | S | In the second exon ~900 bp from the start codon in all genes. |
LR1 | ATCRTYGCCATYSTGGCYG | AS | In the first exon ~50 bp from the start codon in all genes. |
R5 | AAATGGCGGTCCGATGRGTG | AS | In the second exon ~800 bp from the start codon in most genes |
R6 | GAGAMGAAGAAACTGATGCTGC | AS | In the second exon ~900 bp from the start codon in all genes. |
R9 | CGACATYTTCACCACYTDAAG | AS | In the second exon ~ 1.5 kb from the 5' end of most genes |
3' UTR.1 | GTCGCYGAGGTGTAGAATTW | AS | 3' end of all genes |
3' UTF-1 | CGTCATAACCGTACCAAAGAC | S | 3' end of some genes |