Skip to main content

Table 5 Oligonucleotides used in this study

From: Identification of small RNAs in Francisella tularensis

Oligonucleotide Sequence (5' to 3' direction)a Use
3' adapter P--rUrUrUCGGGCCGCGGACTGTidT cDNA cloning and RACE
5' adapter GATATGCGCGAATTCCTGTAGAACGAACACTAGGGGrArArA cDNA cloning and RACE
5'PRIMER GTAGAACGAACACTAGGGGAAA cDNA cloning and RACE
3'PRIMER GACAGTCCGCGGCCCGAAA cDNA cloning and RACE
3' adapter_B P-rUrUrUCTATCCATGGACTGTidT cDNA cloning tmRNA
5' adapter_B GATATGCGCGAATTCCTGTAGAACGAACACTAGAAGrArArA cDNA cloning tmRNA
5'PRIMER_B GTAGAACGAACACTAGAAGAAA cDNA cloning tmRNA
3'PRIMER_B TACAGTCCATGGATAGAAA cDNA cloning tmRNA
ftrA_GSP_5'RACE GTTATTCAGACGTGTCAAACAGAG 5'-RACE ftrA
ftrA_GSP_3'RACE GTACCAAATAATTAATGCTCTGTAATC 3'-RACE ftrA
ftrB_GSP_5'RACE GAGATTCCCGCCTACGCGG 5'-RACE ftrB
ftrB_GSP_3'RACE GATACTAACTTAACGTCGGTAGTC 3' RACE ftrB
ftrA_DelR GCGCGGCCGC GTGGTAAAATCATCTAGGTTCTAGC Deletion ftrA
ftrA_DelB CATTTATAATTTTAGATATTTTTTCGC Deletion ftrA
ftrA_DelO GCGAAAAAATATCTAAAATTATAAATG GGCAATTAATATATCTTGTTCGCTTCTTAGC Deletion ftrA
ftrA_DelT GCGTCGAC GCAACTAAGAAAAGAATATTTAATAGCC Deletion ftrA
ftrA_DelCheck1 CATATGTAGTGTACTTTATTTAAATAC Verification of ftrA deletion
ftrA_DelCheck2 CCTAAGTTTCAGTTGCTGAATTATTTGG Verification of ftrA deletion
ftrA_DelCheck3 GCCACTGAAGGCGGAAATCTCGC Verification of ftrA deletion
ftrA_DelCheck4 CAGTTAAATATTATTAACATTAAGAAAC Verification of ftrA deletion
ftrB_DelR GCGCGGCCGC CTTTTAAGATTTGTATTCTTATTTGTTC Deletion ftrB
ftrB_DelB CACTACCCCGTATTGCTTCGCAAGCC Deletion ftrB
ftrB_DelO GGCTTGCGAAGCAATACGGGGTAGTGCCTAAGGAGTCAAACTAACAAAGGGGCCTGC Deletion ftrB
ftrB_DelT GCGTCGAC CAGAGCATTTATGATAGTTTGTTTTCC Deletion ftrB
ftrB_DelCheck1 CTAAATCTAAGGAATGATAATTAACC Verification of ftrB deletion
ftrB_DelCheck2 GGACAGGAATGGACAGCAGAAG Verification of ftrB deletion
ftrB_DelCheck3 GTATATCCTATTTGAAAAGCTAATGGC Verification of ftrB deletion
ftrB_DelCheck4 CACTATATGGATATGCTTATGAACAAGC Verification of ftrB deletion
ProbeA CAGACGTGTCAAACAGAGGTCCGTTCAAAATAC Northern blot
ProbeB GAGATTCCCGCCTACGCGGGAATGACTACCGACG Northern blot
FTL_0044_F GCTATATGTCCCAGGTGTAAGG qRT-PCR
FTL_0044_R GCTCTTTGGCTTTTTTAGGGGTC qRT-PCR
FTL_0421_F GGGCAACTGTAACAGTTAAGC qRT-PCR
FTL_0421_R CTTCTTTGTCATAAACTACATTAGC qRT-PCR
FTL_0836_F GTGGCTATTGATGACATACTCAAC qRT-PCR
FTL_0836_R GCTAAGCCTAGATAACTGATACC qRT-PCR
FTL_1922_F GGATTTGATTTTTCTCCAATTATTG qRT-PCR
FTL_1922_R CTGCGCAATAATGCTTTGTATG qRT-PCR
  1. a Bases preceded by r designates a ribonucleotide whereas all other are deoxyribonucleotides. idT designates an inverted deoxythymidine. P designates a phosphorylated 5' end. Not I site is underlined. Sal I site is shown in italics.