Skip to main content

Table 1 Primer sequences for amplifying full-length Ssa-NILT2, 3 and 4, and Ig domains

From: Genomic organisation analysis of novel immunoglobulin-like transcripts in Atlantic salmon (Salmo salar) reveals a tightly clustered and multigene family

Primers Sequence (5'-3') Amplifying
Ssa-NILT-f1 ACTAGCTGGGAGCCACAAGTCATC Ssa-NILT2/Ssa-NILT4
Ssa-NILT-f2 CATCATGGTTATCTTGCTGGTCAT Ssa-NILT3
Ssa-NILT-r1 TTGACGTTGGCGTAGTTGAG Ssa-NILT2/Ssa-NILT3
Ssa-NILT-r2 GTCCCTTATGATTGGTTGTCAGTG Ssa-NILT4
Ssa-panIg-f GAGTTGATCACAGTGGAAGGA Pan-NILT Ig
Ssa-panIg-r TCCRCACCAGTATSTYCCAGC Pan-NILT Ig