Skip to main content

Table 2 Let 7 family of miRNAs are secreted by hES-MSC in large numbers. This table lists common transcripts in the extracellular samples that belong to the mid-range category of between 32 to 10,000 transcripts showing a predominance of let 7 family of miRNAs. It is interesting to note that no transcripts with counts greater than 10,000 were observed in the extracellular space.

From: Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of Hepatic Nuclear Factor 4 Alpha

Extracellular
Transcript Number (Sample 1)
Extracellular
Transcript Number (Sample 2)
Extracellular
Transcript Number Sample 3
Transcript Sequence miRNA Annotation
826 3653 3734 TGAGGTAGTAGATTGTATAGTT hsa-let-7f
679 2748 1870 TGAGGTAGTAGTTTGTACAGTT hsa-let-7g
287 69 331 AAGCTGCCAGTTGAAGAACTGT hsa-miR-22
254 992 249 TGGAATGTAAAGAAGTATGTAT hsa-miR-1
243 605 997 ACAGTAGTCTGCACATTGGTTA hsa-miR-199a-3p
215 1225 931 TGAGGTAGTAGGTTGTATAGTT hsa-let-7a
182 227 644 TAGCTTATCAGACTGATGTTGA hsa-miR-21
170 100 515 TCAGTGCATGACAGAACTTGG hsa-miR-152
164 389 834 TAGCACCATCTGAAATCGGTTA hsa-miR-29a
112 42 160 TCCCTGAGACCCTAACTTGTGA hsa-miR-125b
95 1051 149 TGAGGTAGTAGGTTGTATGGTT hsa-let-7c
94 40 156 TGGCTCAGTTCAGCAGGAACAG hsa-miR-24
87 159 100 AAAAGCTGGGTTGAGAGGGCGA hsa-miR-320a
82 308 334 TGAGGTAGTAGTTTGTGCTGTT hsa-let-7i
81 97 43 TGAGGGGCAGAGAGCGAGACTTT hsa-miR-423-5p
71 55 310 TGGAGAGAAAGGCAGTTCCTGA hsa-miR-185
66 46 256 AACCCGTAGATCCGAACTTGTG hsa-miR-100
66 502 277 TGAGATGAAGCACTGTAGCTC hsa-miR-143
39 104 87 AGAGGTAGTAGGTTGCATAGTT hsa-let-7d
39 111 194 AGCTACATTGTCTGCTGGGTTTC hsa-miR-221