Skip to main content

Table 2 Primer/ probe list

From: Gene expression analyses of immune responses in Atlantic salmon during early stages of infection by salmon louse (Lepeophtheirus salmonis) revealed bi-phasic responses coinciding with the copepod-chalimus transition

S.N Sequence Definition Code   Primer/ probe (5'-3') Product length GenBank Accession (GI)
1. Apoptosis regulator Bcl-X Apo Fwd TACTAAGTGTTGCCGTTGA 109 209734267
    Rev TAATCCAATCTGTGTCATTCTG   
2. Beta-2-microglobulin precursor B2M Fwd CACAGACAGACACAGACA 102 221220497
    Rev CAACGATTGACAGAATAGACTT   
3. Carboxypeptidase A1 precursor CarPep Fwd AGCATACCAAGGACAACAC 75 209732661
    Rev TACAACAGTACAATGACACAGT   
4. Chymotrypsin B ChyTry Fwd CTGTCCATACTGTATATTGCTAT 111 209734305
    Rev GCTATAATGCTTAGGTGTTGTA   
5. Collagenase 3 precursor COL3 Fwd ATCTGTGCTTACTACTAATCAAC 81 209156091
    Rev GGGCTTCATCTTCTTTACTG   
6. Complement C1q subcomponent subunit B precursor C1qB Fwd CTGTCTGTCGTTGTCTTC 89 223649475
    Rev ATGGTCTGTTGGTCTGTA   
7. Elastase-1 Ela Fwd ACCGTCAACAAAGTCTTCA 75 S31963336
   Rev   CAGCAGAGCGATGTCATA   
8. Fish virus induced TRIM protein TRIM Fwd GCATGGCACAATAATAACT 75 S35697379
    Rev GTCCAGATACACTCCTAC   
9. Trypsin-2 Try2 Fwd CAGTTGTCGGTTGAGATG 81 S18845530
    Rev CAAGATGTGCCAGATAGC   
10 Trypsin-3 Try3 Fwd CATTATTCTTCTCGCTCTG 81 S31964271
    Rev TCATACCCTCCAACAATC   
11 Tumor necrosis factor alpha TNFα Fwd ACAAAGAGGGCCAGGGATTC 100 126507266
    Rev GAGGCCTGGCTGTAGACGAA   
12 Interleukin-1 receptor-like protein IL1R1 Fwd AGCAGGATGTCCTCGGTCTA 202 185136290
    Rev TGGGTAGCGGTGTAGTTTCC   
13 Interleukin-1 beta IL1β Fwd ACCGAGTTCAAGGACAAGGA 196 186288127
    Rev GCAGCTCCATAGCCTCACTC   
14 Gamma-interferon-inducible lysosomal thiol reductase GIILTR Fwd CTATGTGCCTTGGATTGT 79 209732609
    Rev CAGAGTGAAGAGTGAAGAC   
15 HSP70_ONCMY Heat shock cognate 70 kDa protein HSP70 Fwd TCACTAGAGTCCTATGCT 85 CL7Contig1
    Rev TTGTCTTGTCCTCATCAC   
16 Lipopolysaccharide-induced TNF-a factor homolog LPSi-TNFα Fwd CAATTCCTTCGACCTCAT 85 209734201
    Rev GCTCTTCTCCATACTGTC   
17 Metalloreductase STEAP4 STEAP4 Fwd CTCCAACTCTGAAGACTATT 103 S48396453
    Rev GAGCACTGTCAATCAATG   
18 Myosin, heavy polypeptide 9, non-muscle Myo Fwd GCAGTTGAGACTCTACAGTGGAA 75 CB498954
    Rev ACAGCGTGTTGAGTGTGGTT   
19 Programmed cell death protein 2 PCDP Fwd GCATAGACAGCCACAATC 81 209735097
    Rev GAGCGTAACAACCTGAAG   
20 Prostaglandin E synthase 3 PGES Fwd TCCAGCCAATGTCTTAGT 99 223672934
    Rev AAGCACGGTATAACTGAAC   
21 P-selectin precursor P-sel Fwd CTGGTGATTCTATTGATGAC 86 209154193
   Rev   TTGACGCTGTAGTTGTAT   
22 CD8α CD8α Fwd CGTCTACAGCTGTGCATCAATCAA 118 185135177
    Rev GGCTGTGGTCATTGGTGTAGTC   
23 Interleukin-12 IL-12 Fwd TCTACCTACACGACATTGTCCAGCC 62 209736091
    Rev ATCCATCACCTGGCACTTCATCC   
24 Prostaglandin D synthase PGDS Fwd ATCCCAGGCCGCTTCAC 59 304376917
    Rev ACACGCATGTCATTTTCATTGTT   
    Probe TTCACCAGCCAGCGTT   
25 Matrix metalloproteinase-13 MMP13 Fwd GCCAGCGGAGCAGGAA 56 213514499
    Rev AGTCACCTGGAGGCCAAAGA   
    Probe TCAGCGAGATGCAAAG   
26 T-cell receptor alpha TCRα Fwd GACAGCTACTACAGCCAGGTT   209736003
    Rev CAGAATGGTCAGGGATAGGAAGTT   
    Probe ACACAGATGCAAAGATC   
27 CD3ε CD3ε Fwd TCAGGGCTCGGAAGAAGTCT 68 185135943
    Rev GCCACGGCCTGCTGA   
    Probe CCAAAAACCCACTTCCC   
28 CD4-like protein, variant 1 CD4-1 Fwd GAATCTGCCGCTGCAAAGAC 75 185135736
    Rev AGGGATTCCGGTCTGTATGATATCT   
    Probe CCCAAACCAAAAGGATTC   
29 CD8β CD8β Fwd GGAGGCCAGGAGTTCTTCTC 70 185135192
    Rev GGCTTGGGCTTCGTGACA   
    Probe ACCCGGAGAAACTC   
30 MHC class I antigen MHC-I Fwd CAACGCCACAGGCAGTCA 64 25573077
    Rev CGGTACTCATTCTGAGCTGTGTTAC   
    Probe CACCAAACTCAAGTGGG   
31 MHC class II antigen MHC-II Fwd CTCACTGAGCCCATGGTGTAT 117 223672978
    Rev GAGTCCTGCCAAGGCTAAGATG   
    Probe CTGGGACCCGTCCCTG   
32 Immunoglobulin mu IgM Fwd TGAGGAGAACTGTGGGCTACACT 69 2182101
    Rev TGTTAATGACCACTGAATGTGCAT   
    Probe CATCAGATGCAGGTCC   
33 Immunoglobulin tau IgT Fwd CAACACTGACTGGAACAACAAGGT 97 260766539
    Rev CGTCAGCGGTTCTGTTTTGGA   
    Probe AGTACAGCTGTGTGGTGCA   
34 Elongation factor 1A EF1A Fwd CCCCTCCAGGACGTTTACAAA 57 224587629
    Rev CACACGGCCCACAGGTACA   
    Probe ATCGGTGGTATTGGAAC