Skip to main content

Table 6 Characteristics of "unique" nucleotide signatures for rrs sequences of 15 different Clostridium spp

From: Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

Clostridium sp. Signature
  Nucleotide sequence (30 nts) No.a Frequencyb
C. beijerinckii ATATCTAGAGTGCAGGAGAGCAAAGTAGAA M10 23/23
C. sporogenes AATCGCATGATTATCTTATCAAAGATTTAT M1 11/11
C. butyricum ACTTGACATCTCCTGAATTACTCTGTAATG M3 32/32
  TACAATGGTCGGTACAATGAGATGCAACCT M9 32/32
C. colicanis AAAGGGAGATTAATACCTCATAATATCCTA M1 9/9
  AAAACTTTAAAACCGGTCTCAGTTCGGATT M3 9/9
  ATACATGGATTAAAGGAGCAATCCGCTATA M5 9/9
  TAGGCGGATCTTTAAGTGGGATGTGAAATA M9 9/9
C. kluyveri AGATTAATACCGCATAGAAGGTAAAAATCG M2 14/14
  AGGCGGATATTTAAGTGAGATGTGAAAGAC M4 14/14
  AGTGCATTTCAAACTGGATATCTAGAGTGC M5 14/14
  AAATCTCAAAAACTGCCCCCAGTTCGGATT M9 14/14
  AAGAAGGTTTTCGGATCGTAAAGCTCTGTC M10 14/14
C. pasteurianum CGAAAGGGAGATTAATACCGCATAATATTA M2 13/13
  AAATGCGTAGAGATTAGGAAGAACATCAGT M3 13/13
  ATTGTAAAGCTCTGTCTTTTGGGACGATAA M5 13/13
  TAAACGATGAGTACTAGGTGTAGGAGGTAT M7 13/13
  TACAATGGTGAGAACAACGAGATGCAATAC M8 13/13
C. perfringens TTAGTTACTACCATTAAGTTGAGGACTCTA M1 92/92
  ACACTTGACATCCCTTGCATTACTCTTAAT M2 92/92
  TAGGCGGATGATTAAGTGGGATGTGAAATA M3 92/92
  AAGGTTTTCGGATCGTAAAGCTCTGTCTTT M4 92/92
  TTATGTGTAGGGCTACACACGTGCTACAAT M5 92/92
C. chauvoei AAAGGAAGATTAATACCGCATAATATTGCA M1 8/8
  AGACTTGACATCTCCTGCATTACTCTTAAT M3 8/8
  AGTAATTAAAGGAGCAATCCGCTACAAGAT M4 8/8
  TAAACTATAATACTTGTCTCAGTTCGGATT M5 8/8
  AACTTGGGTGCTGCATTTCAAACTGGAAGT M8 8/8
  AAGGTTTTCGGATCGTAAAGCTCTGTCTTC M9 8/8
C. tetani AACCCTTATTATTAGTTGCTACCATTAAGT M1 8/8
  TTAAGTGAGATGTGAAATACCTAAGCTTAA M2 8/8
  AAAGGAGGATTAATACCGCATAAAGTTAAG M3 8/8
  TTTAACCAAAGGAGTAATCTGCTTTGAGAT M4 8/8
  AGTTGCTAGTAATCGCAAATCAGAATGTTG M5 8/8
  TTCTGTGCCGCAGTTAACACATTAAGTATT M6 8/8
  AAATCTCAAAAACCGATCCCAGTTCGGATT M7 8/8
  AAGGTTTTCGGATCGTAAAACCCTGTTTTC M8 8/8
  ACGGTCGCAAGACTAAAACTCAAAGGAATT M9 8/8
C. baratii c TTGTAAAGCTCTGTCTTTGGGGACGATAAT M3 8/8
  ATTTTTAAGTGGGATGTGAAATACCCGGGC M6 8/8
C. sardiniense c AAAGGAAGATTAATACCGCATAACATTGCA M1 9/9
  TAAACTTCAAAACTTGTCTCAGTTCGGATT M2 9/9
  TTCGCATGAAACAGCAATTAAAGGAGCAAT M4 9/9
  CTACAATGGCAAGTACAGAGAGATGCAATA M9 9/9
  GTAAACGATGAATACTAGGTGTAGGGGTTT M10 9/9
C. botulinum
(CBoI - 83/128) c,d
AAAACTTATAAAACCTATCTCAGTTCGGAT M1 82/83
  AACCCTTGTTATTAGTTGCTACCATTAAGT M2 83/83
  AAGGTCTTCGGATTGTAAAGCCCTGTTTTC M7 83/83
  GTAGGCGGATGTTTAAGTGGGATGTGAAAT
TAAACGATGGATACTAGGTGTAGGGGGTAT
M8
M9
83/83
82/83
C. novyi c AAAGGGAGATTAATACCGCATAACATTATT M1 17/17
  AAGATTAAAACTCAAAGGAATTGACGGGGA M3 17/17
  ACTTTCTGGACTGTAACTGACACTGAGATA M6 17/17
  TTAAGTCAGATGTGAAATTCCCGGGCTTAA M10 17/17
C. subterminale c AATGAAGAAGGCCTTAGGGTTGTAAAGTTC M6 8/8
C. acetobutylicum No unique signature could be found - 24/24
  1. aRefer to Additional file 8: Figures S20-S36 and Additional file 9: Tables S5-S20
  2. bFrequency of occurrence of the signature out of the total sequences screened.
  3. cCan be designated as unique signatures if we assume i) C. baratii and C. sardiniense and ii) C. botulinum, C. novyi and C. subterminale to belong to single sp. based on phylogenetic framework and in silico analyses
  4. dOut of the two groups of 45 and 83 organisms, no unique signature could be detected in the first group
\