Skip to main content

Table 5 Sites experimentally tested for in vivo AtoC binding

From: Escherichia coli genome-wide promoter analysis: Identification of additional AtoC binding target elements

Result Site Gene Motif Strand Site distance from TSS (Refseq) Gene product
+ GCTATGCAGAAATTTGCACA atoD 1,2,3,4 (+) -184 -165 acetyl-CoA: acetoacetyl-CoA transferase, subunit
+ GCTATGCAGAAAATTGCGCA atoD 1,2,4 (-) -163 -144 acetyl-CoA: acetoacetyl-CoA transferase, subunit
+ GCTATAGAAATAATTACACA dmsA 1,2 (-) -69 -50 dimethyl sulfoxide reductase, anaerobic, subunit A [25]
+ GCCATGCGGGGATTTAATCA puuP 1 (+) -148 -129 putrescine importer [24]
+ GCCGTCCAGATGTTTACACA* metR-metE 1 (-) -87, -170 -68, -151 transcriptional activator [30]
+ GCGATTGTAGGGATTGCTCA* trmA-btuB 1,(2) (+) -49, -340 -30, -321 tRNA (uracil-5-)-methyltransferase/ outer membrane transporter [31]
+ ACTATACGGAAAATTCCACT* ykgA-ykgQ 1,2 (-) -235, -55 -216, -36 Putative transcriptional activator [32]
+ GTGATGGGATTATTTGATCT* aegA-narQ 1 (-) -147, -79 -128, -60 predicted fused oxidoreductase: FeS binding subunit and sensory HK in TCS with NarP [33, 34]
+ GCCTCGGAGGTATTTAAACA* cpxR-cpxP 1 (-) -21, -149 -2, -130 response regulator in TCS with CpxA/ periplasmic protein; combats stress [36]
+ GCGAGGCGGGTAATTAGACA ymiA 1 (-) -199 -180 small predicted membrane protein [35]
+ GGCCCAATTTACTGCTTAGG crr 1,2 (+) -28 -9 glucose-specific PTS component [26]
+ GCGGTGCAGGAGATTGCACA fliT 1 (+) 127 146 predicted chaperone (flagellum) [46]
+ CCGGTCCAGGAATTTACTCA narG 1 (-) 2 21 nitrate reductase 1, alpha subunit [23]
+ GCGAAACGATTAATTACACA ycjM 1 (+) 94 113 glucosyltransferase predicted [64]
+ ACTGTACAGAAAGTTGCTCA yeaM 1 (-) 668 687 transcription regulator (predicted) [65]
+ GCGGGTCAGGTAATTGCACA gadA 1 (-) 959 978 glutamate decarboxylase A, PLP-dependent [66]
+ GACATGCAGTTGATTACACA eutR 1 (+) 783 802 predicted transcription regulator [67]
+ GCGATCCAAAAGTTTACTCA narZ 1 (+) 0 + 19 nitrate reductase 2 alpha subunit [23]
+ CGGAGATTTCCCGCAAAGCC* rtcB-rtcR 2 (+) -145, -64 -126, -45 sigma-54-dependent transcriptional regulator of rtcBA [27]
+ CGGCAAGTTTCGACATTGCC* putA-putP 2 (+) -398, -45 -379, -26 fused transcriptional regulator/proline dehydrogenase/ carboxproline:sodium symporter [37]
- GGGCATTTTCCTGCAAAACC* rhaT-sodA 3 (+) -167, -138 -148, -119 L-rhamnose:proton symporter/superoxide dismutase [39, 40]
- GGATGATGTTCTGCATAGCA adhP 3 (+) -35 -16 ethanol-active dehydrogenase/acetaldehyde-active reductase [38]
- TTTATAGAAATAGATGCACG nirB 4 (-) -205 -186 nitrite reductase, large subunit, NAD(P)H-binding [41]
+ TATGTGTAGAAAATTAAACA borD 4,3 (+) -59 -40 DLP12 prophage; predicted lipoprotein [28]
+ GTTCAGTATAAAAGGGCATG acrD 2 (+) -128 -109 aminoglycoside/multidrug efflux system [29]
- GAAATAGAAATAGTTGAAAG ykgE 4 (-) -472 -453 predicted oxidoreductase [32]
+ CCGGATAAGGCGTTTACGCC yjcH 4 (+),(-) -114, -122 -95, -103 conserved inner membrane protein/ acetate transport [44]
- CCGGATAAGACGTTTACGCC yafJ 4 (+) -193 -174 Unknown function, similarity to type II amidotransfease
+ CCGGATAAGGCGTTTACGCC sseB 4 (+) -125 -106 rhodanese-like enzyme [68]
  1. Motif hits experimentally tested by ChIP analysis for in vivo AtoC binding. All annotations were provided by the Refseq database (Escherichia coli K12, Refseq id: NC_000913). Underlined: hits in gene-encoding regions. *These hits represent a unique site per pair, which could be attributed as cis-regulatory element to both flanking genes. As predicted by the GO Term analysis many of the targets are transcription factors, transporters and enzymes involved in oxidoreduction.