Skip to main content

Table 2 Oligos and genomic targets used in this study

From: Genomic comparison of multi-drug resistant invasive and colonizing Acinetobacter baumannii isolated from diverse human body sites reveals genomic plasticity

Primer name Forward (5'-3') Reverse (5'-3') gene target gene target accession Phenotype target
AB_UNI CTTTCAGGKAGTATTGGTCT CTCATTAGAGTTCACCGAAG hypothethical protein ACJ58112 all
AB_HYP CGTCGGTCGGATCCGTGTAT AAGTAAAGTGGCAGGCGCTT hypothetical protein ACJ57861 invasion
AB_INV ATCCATTAGACCTCCCAATC CATTGTTGATGTGAACTGGA hypothetical protein ACJ42779 invasion
AB_HEM TCTCATCTAAAGCACCACCC TAACCAGTGCTGGTGACATC hemolysin ZP_04662166 colonization
AB_COL TCCAATGCCAAATCTTTACT TGTGTTGAATAACCCTCAAA alkyl sulfatase ZP_04663686 colonization
AB_ALK TTCCTGTTATAAGATTGGGAGAA TTCTGATCCGAGTGATTTATTG alkyl sulfatase ZP_04663686 colonization
AB_INT TATCCTTCAGCTTACCCTTCTT TTTCGACATGTGGTAGACTGTT Integrase ZP_04661979 colonization
pOX TGGCGATCAATTCTTACTTT CGTAACGAAACGAAGTAATG phenol hydroxylase ZP_05824220 none