Skip to main content

Table 1 MicroRNAs rescreened after primary screen in monocytes and dendritic cells, and their differences in expression level between cell types

From: MicroRNA genes preferentially expressed in dendritic cells contain sites for conserved transcription factor binding motifs in their promoters

MicroRNA in assay Mature miRNA Sequence Current genomic entries in miRbase matching mature miRNA Up in DC Up in DC subset Up in monocytes No difference
hsa-let-7e UGAGGUAGGAGGUUGUAUAGU same X    
hsa-miR-15b UAGCAGCACAUCAUGGUUUACA same    X  
hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG hsa-miR-16-1, hsa-miR-16-2    X  
hsa-miR-27a UUCACAGUGGCUAAGUUCCGCC same     X
hsa- miR-27b UUCACAGUGGCUAAGUUCUG same     X
hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU same X    
hsa-miR-99a AACCCGUAGAUCCGAUCUUGUG same X    
hsa-miR-100 AACCCGUAGAUCCGAACUUGUG same X    
hsa-miR-125a UCCCUGAGACCCUUUAACCUGUG same X    
hsa-miR-125b UCCCUGAGACCCUAACUUGUGA hsa-miR-125b-1, hsa-miR-125b-2 X    
hsa-miR-126 UCGUACCGUGAGUAAUAAUGC same     X
hsa-miR-130a CAGUGCAAUGUUAAAAGGGC same    X  
hsa-miR-132 UAACAGUCUACAGCCAUGGUCG same     X
hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA hsa-miR-135a-1, hsa-miR-135a-2 X    
hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG same X    
hsa-miR-140 AGUGGUUUUACCCUAUGGUAG same     X
hsa-miR-146 UGAGAACUGAAUUCCAUGGGUU hsa-miR-146a   X   
hsa-miR-150 UCUCCCAACCCUUGUACCAGUG same    X  
hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG same   X   
hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU same     X
hsa-miR-199b CCCAGUGUUUAGACUAUCUGUUC same    X  
hsa-miR-199-s CCCAGUGUUCAGACUACCUGUU hsa-miR-199a-1, hsa-miR-199a-2    X  
hsa-miR-210 CUGUGCGUGUGACAGCGGCUG same   X