Skip to main content

Table 2 Predicted miRNAs in A. auriculiformis and A. mangium.

From: Identification of lignin genes and regulatory sequences involved in secondary cell wall formation in Acacia auriculiformis and Acacia mangium via de novo transcriptome sequencing

miRNA family mature miRNA sequence
(5'-3')
miRNA
mismatch
Length (nt) MFE GC % MFEI
aau-miR319 uuggacugaagggagcucccu 3 197 -68.9 41.1 0.85
aau-miR396 uuccacagcuuucuugaacug 0 146 -63.0 44.5 0.97
aau-miR2086 gacaugaaugcagaacuggaa 0 87 -23.4 39.1 0.69
aau-miR160 uggcauacagggagccaggca 0 88 -29.4 56.8 0.59
aau-miR162 ucgauaaaccucugcauccag 0 103 -40.0 48.5 0.80
aau-miR168 auucaguugaugcaaggcgggauc 2 127 -57.8 59.1 0.77
aau-miR172 ugagaaucuugaugaugcugcau 0 165 -59.6 40.6 0.89
amg-miR319 guggacugaaggaagcucucu 0 182 -82.0 41.2 1.09
amg-miR396 uuccacagcuuucuugaacug 0 145 -63.8 44.1 1.00
amg-miR2086 gacaugaaugcagaacuggaa 0 87 -23.4 39.1 0.69