Skip to main content

Advertisement

Table 3 Primers used for PCR amplification and Sanger sequencing

From: Exome-wide DNA capture and next generation sequencing in domestic and wild species

Gene Forward (5' to 3') Reverse (5' to 3')
CSN3 AGAAATAATACCATTCTGCAT GTTGTCTTCTTTGATGTCTCCTTAGAG
LEP GATTCCGCCGCACCTCTC CCTGTGCAAGGCTGCACAGCC
TICAM2 TCCTCTTCTGACTCGGATCTTT CCAAGTTCTGTAAATGCTGTCTGC
TLR2-f1 TGGGTCTGGGCTGTCATCAT AAGAGATGTTTCCCCAAGTGTTTT
TLR2-f2 GACCTGCAGAGGTGTGTGAA TGAAAAATGGAAAGTGTGCAA
TLR4-f1 CGGGGAGAGACGACACTACA TGTTTGCAAATGAACCTAACCA
TLR4-f2 TCTTTGCTCGTCCCAGTAGC AAGTGAATGAAAAGGAGACCTCA
TLR4-f3 GGAGACCTAGATGACTGGGTTG GGGGCATTTGATGTAGAACTTT