Skip to main content

Table 1 Primers used in PCR validation of a CNV located on chromosome 12 in Nipponbare, Guang-lu-ai 4, and some other varieties of indica and japonica.

From: Detection of copy number variations in rice using array-based comparative genomic hybridization

Primer Forward Reverse
PP16-13477617 TGCGCTTCTTTGGCCTTCCGAT TGAGCAAGCTGCGTACAAGGTT
PP16-13478047 GCATTGGGCTAAAAAGCAAGGCGC TGGAGGCCCTCAAGCATATCCCA
PP16-13478457 TTGGACCTGCTGTGAGCCCGAT ACCGCCTTTGGTCTCCCTCGTAC
PP16-13478857 GCTGCAAAGCGGACCCTAGCT AGCTAATGATGGCTCACGAGAAGC