Skip to main content

Table 3 Structural features of CRISPR loci detected in the C. ulcerans genomes

From: Comparative analysis of two complete Corynebacterium ulcerans genomes and detection of candidate virulence factors

Name No. of cas genes No. of spacers CRISPR size CRISPR consensus sequence in both genomes
CRISPR809_I 4 28 29 bp CTTTTCTCCGCGTACGCGGAGGTAGTTCC
CRISPR22_I 4 38 29 bp  
CRISPR809_II 6 12 36 bp ACCTCAATGAAAGGCTGCGACCGAAGCCGCAGCGAC
CRISPR22_II 6 10 36 bp  
CRISPR809_III 0 67 29 bp CTTTTCTCCGCGTATGCGGAGGTAGTTCC
CRISPR22_III 0 32 29 bp