Skip to main content

Table 1 Oligonucleotide primers used for RT-qPCR analysis.

From: Global gene expression of Poncirus trifoliata, Citrus sunki and their hybrids under infection of Phytophthora parasitica

  Description CitEST Forward/Reverse Amp
Selected genes to validate the microarray   
LEA Lea 5 CAS-PT-303903 TCGGACTGGTATCATGGA/GTAGTACCCAGTGATGGGA 99
MIR miraculin CAS-CR-215276 AGCCCTGTAATGAAGAACC/TAGCAACGTTTCAGCTCC 100
TIR TIR-NBS-LRR CAS-CS-103511 CATGATGAGGACGTGGG/AAGTGATCCGACTCGAC 103
RPS4 Disease resistance RPS4 CAS-PT-300852 CCAAGATCTTGAATATCTTCCC/GCAAGTTGAGCTCAATTAGG 112
UNC unclassified proteins CAS-PT-310250 TCTCTTGTTCTTCATGCAGT/TATGCATCTTGCCTTCATTC 116
Selected endogenous control genes   
ETEF2 eukaryotic translation elongation factor 2 CAS-PT-306679 TTGAGGCTTCTGAATCGAG/CTTTCCAGATGAACCTCTCC 97
EGIDH NADP-isocitrate dehydrogenase CAS-CS-112964 CATTGAACATGCAGTTGAGG/ATTCTCATGACGTGTCGG 91
CYC cyclophilin CAS-PT-301486 AGAGTATGCAGAGGAATGG/GTCCTTAACAGAAGTCCGT 107
UBQ ubiquitin CAS-PT-300961 TTCGTCAGTTGACTAATCCT/GTTGCTGTGTTGACTGTG 95
TUB tubulin - TTTGTAAGATCCCTCCGA/TCACCCTCCTGAACATTT 87
\