Skip to main content

Table 2 Known plant miRNAs identified in melon

From: Analysis of the melon (Cucumis melo) small RNAome by high-throughput pyrosequencing

Annotation Melon sRNA sequence (5'-3') Similarity Number of miRNA sequences miRNA* sequences Hit in melon genomea
miR156|a, b, c, d, e, f UGACAGAAGAGAGUGAGCAC 100% 469 60 YES
miR157|a, b, c UUGACAGAAGAUAGAGAGCAC 100% 269 0 YES
miR157|d UGACAGAAGAUAGAGAGCAC 100% 19 21 YES
miR158|a UCCCAAAUGUAGACAAAGCA 100% 1 0 --
miR159|a UUUGGAUUGAAGGGAGCUCUA 100% 14651 0 YES
miR159|b UUUGGAUUGAAGGGAGCUCUU 100% 18 0 --
miR159|c UUUGGAUUGAAGGGAGCUCCU 100% 1 0 --
miR160|a, b, c UGCCUGGCUCCCUGUAUGCCA 100% 537 0 YES
miR161|a.1 UUGAAAGUGACUACAUCGGGG 100% 6 0 --
miR161|a.2 UCAAUGCAUUGAAAGUGACUA 100% 1 0 --
miR162|a, b UCGAUAAACCUCUGCAUCCAG 100% 825 0 YES
miR164|a, b UGGAGAAGCAGGGCACGUGCA 100% 172 1 YES
miR165|a, b UCGGACCAGGCUUCAUCCCCC 100% 4 0 --
miR166|a, b, c, d, e, f, g UCGGACCAGGCUUCAUUCCCC 100% 65 27 YES
miR167|a, b UGAAGCUGCCAGCAUGAUCUA 100% 136 0 YES
miR167|d UGAAGCUGCCAGCAUGAUCUGG 100% 16 1 --
miR168|a, b UCGCUUGGUGCAGGUCGGGAA 100% 967 0 YES
miR169|a CAGCCAAGGAUGACUUGCCGA 100% 3 1 --
miR169|b, c CAGCCAAGGAUGACUUGCCGG 100% 76 1 YES
miR169|h, i, j, k, l, m, n UAGCCAAGGAUGACUUGCCUG 100% 83 1 YES
miR170|a UGAUUGAGCCGUGUCAAUAUC 100% 3 0 --
miR171|a UGAUUGAGCCGCGCCAAUAUC 100% 85 5 YES
miR171|b, c UUGAGCCGUGCCAAUAUCACG 100% 64 0 YES
miR172|a AGAAUCUUGAUGAUGCUGCAU 100% 85 58 YES
miR172|c, d AGAAUCUUGAUGAUGCUGCAG 100% 4 0 YES
miR172|e GGAAUCUUGAUGAUGCUGCAU 100% 3 0 YES
miR319|a, b UUGGACUGAAGGGAGCUCCC 100% 2 3 YES
miR390|a, b AAGCUCAGGAGGGAUAGCGCC 100% 32 6 YES
miR391|a UUCGCAGGAGAGAUAGCGCCA 100% 1 0 --
miR393|a, b UCCAAAGGGAUCGCAUUGAUC 100% 18 0 YES
miR394|a, b UUGGCAUUCUGUCCACCUCC 100% 4 0 YES
miR396|a UUCCACAGCUUUCUUGAACUG 100% 134 84 YES
miR396|b UUCCACAGCUUUCUUGAACUU 100% 82 16 YES
miR397|a UCAUUGAGUGCAGCGUUGAUG 100% 26 0 YES
miR408|a AUGCACUGCCUCUUCCCUGGC 100% 14 1 YES
ath-miR2111a UAAUCUGCAUCCUGAGGUUUA 100% 1 0 YES
peu-miR2910 UAGUUGGUGGAGCGAUUUGUC 100% 8 0 YES
osa-miR167d UGAAGCUGCCAGCAUGAUCUG 100% 3401 1 YES
tae-miR395b UGAAGUGUUUGGGGGAACUC 100% 1 0 YES
bna-miR397a CAUUGAGUGCAGCGUUGAUGU 95% 77 0 YES
miR156|h UUGACAGAAGAGAGUGAGCAC 95% 91 0 YES
miR156|g ACAGAAGAGAGUGAGCACA 90% 5 0 YES
miR169|d, e, f, g UGAGCCAAGGAUGACUUGCCU 95% 130 0 YES
miR169|d, e, f, g UGAGCCAAAGAUGACUUGCCU 90% 112 0 YES
miR399|a UGCCAAAAGAGACUUGCCCUG 95% 3 0 YES
miR403|a CUAGAUUCACGCACAAGCUCG 90% 1 0 --
  1. a Sequences with hit in melon genome = 'YES'; sequences with no hit = '--'