Skip to main content

Table 5 miRNA targets identified in melon transcripts for potential ta-siRNAs derived from unigene c15d_05-D02-M13R_c

From: Analysis of the melon (Cucumis melo) small RNAome by high-throughput pyrosequencing

Melon sRNA name sRNA sequence Targeted unigene Unigene sense Score (miRanda) Unigene annotation
a11_156739_ AGTTTGCTTCTTGGGCTCTTC cA_05-B09-M13R_c Forward 175 IAA16; transcription factor
a11_156739_ AGTTTGCTTCTTGGGCTCTTC cPS_07-G03-M13R_c Forward 175 IAA16; transcription factor
a14_55988_ AGAGCCCAAGAAGCAAACTGG cCL678Contig1 Forward 172 auxin efflux carrier family protein
a24_92242_ AGAGCCCAAGAAGCAAACTG cCL678Contig1 Forward 172 auxin efflux carrier family protein
a33_151240_ CAGTTTGCTTCTTGGGCTCTT c15d_39-H01-M13R_c Forward 171 ARF6 (AUXIN RESPONSE FACTOR 6); transcription factor
a14_362833_ CGATGGTGATGGGATTTTTGA cCL1479Contig1 Reverse 171 IAA9 (INDOLE-3-ACETIC ACID INDUCIBLE 9); transcription factor
a14_362833_ CGATGGTGATGGGATTTTTGA cCL4756Contig1 Reverse 175 ATAUX2-11 (AUXIN INDUCIBLE 2-11); DNA binding/transcription factor
a14_362833_ CGATGGTGATGGGATTTTTGA cP5.72_c Reverse 175 IAA7 (INDOLE-3-ACETIC ACID 7); transcription factor
a33_203464_ CATTTTTTACGATGGTGATGG cCL3310Contig1 Forward 179 ATUBP3 (ARABIDOPSIS THALIANA UBIQUITIN-SPECIFIC PROTEASE 3)
a14_362833_ CGATGGTGATGGGATTTTTGA cCL3310Contig1 Forward 175 ATUBP3 (ARABIDOPSIS THALIANA UBIQUITIN-SPECIFIC PROTEASE 3)
a14_20904_ TACGATGGTGATGGGATTTTT cCL4210Contig1 Forward 174 ubiquitin-associated (UBA)/TS-N domain-containing protein
a11_156739_ AGTTTGCTTCTTGGGCTCTTC cCL1290Contig1 Forward 171 binding/ubiquitin-protein ligase