Skip to main content

Table 2 Primer sequences for RTPCR validation.

From: Genome-wide expression assay comparison across frozen and fixed postmortem brain tissue samples

Gene Name Forward Primer Sequence Reverse Primer Sequence
AIF1 CTCCAGCTTGGTCTGTCTCC TCATCCAGCCTCTCTTCCTG
CACNB1 ACGTCCTCGGATACCACATC CGGTCCTCCTCCAGAGATAC
CASP10 CTTTGGACCTTGGAGCACAC GAACTGGAATACCAATGTTGACC
CTTN GAAACAGGACCAAAAGCTTCC CATCTGGACACCAAACTTGC
EDEM3 GAATTTGAAGATGCAGTGAGAAAA AACTGCTTTGCCATTTGGAG
HAP1 GATGGAGGAGAACAGCAAGC GAATCTGAGTAGAGCTGGAGGAG
IL12RB1 CTGCCTGCAGAACCAGTGAG CAGCTGTGGGACCCTCATAC
LAMA2 TGTTTCTGTTCAGGGGTTTCA TGCTGATCTGCTGAGGTGAG
MTNR1B TCTTGGTGAGTCTGGCATTG TTGAAGACAGAGCCGATGAC
NEUROG2 CAAAGTCACAGCAACGCTGA GAGCAGCACTAACACGTCCTC
NFKB2 CCCTCCCATGGAGGACTG ACCAGACTGTGGGCATGAG
NRXN1 TCAGGAAATTCGCTTTGACC GTGTTGGTGATGCATTTTGG
OPN4 ACCCAGCTGGTGGGACAG CTGTGCCCAGGGTATAGTGG
OR2B6 TGAATTGGGTAAATGACAGCA CATGGGGGTATGAAGTTTGG
PROK1 CACCCCAAGTGACCATGAG CTCGAAGCCACAGGCTGAT
SRC AGATCCGCAAGCTGGACA CTGAGTCTGCGGCTTGGAC
TBX1 GTGTGAGCGTGCAGCTAGAG TCCATGAGCAGCATATAGTCG
TGFA CCTTGGTGGTGGTCTCCAT CGGTTCTTCCCTTCAGGAG
TLR1 AGGCCCTCTTCCTCGTTAGA AATGGCAAAATGGAAGATGC
RPL13A GGGAAGGGTTGGTGTTCAT GGGAAGGGTTGGTGTTCAT
ACTB GCCGTCTTCCCCTCCATC CGTCCCAGTTGGTGACGAT
TBP CGGCTGTTTAACTTCGCTTC CCAGCACACTCTTCTCAGCA
  1. Forward and reverse primer sequences for 19 experimental and 3 reference genes used for RT-PCR to validate microarray results are shown.