Skip to main content

Table 1 Location of 23 microsatellites in the three-spined stickleback genome and primer sequences for nine-spined sticklebacks

From: High degree of sex chromosome differentiation in stickleback fishes

Locus Three-spined stickleback genome Microsatellite marker for nine-spined stickleback
  LG Position (bp) Repeat motif Primer sequence (5'-3') A Allele size (bp)
Ppsm1 XII 188976 (CCT)6 F: GGCTCTTCCGATGAGTTCTC 6    298-308
Ppsm2 XII 3625645 (AC)24 F: GCCTCCCAGTCCTCTGT 5    175-183
Ppsm3 XII 4802750 (GT)16 F: GAACGATGATTAATTTCACTC 42    161-271
Ppsm4 XII 4843632 (CA)15 F: CCAGCTGCTCTGTTTTGTTAAC 16    223-267
Ppsm5 XII 5616109 (GAG)7 F: ATCACGACTCTGAGGAGAG 10    208-241
Ppsm6 XII 7178391 (AC)12 F: ATCGCCCTGCTGGTGGAG 5    231-239
Ppsm7 XII 7695994 (GT)13 F: GCAGCACTGTTGTCCAA 9    73-143
Ppsm8 XII 9015356 (GT)15 F: CCAAAGGCAATTTCAAATCTC 4    203-217
Ppsm9 XII 10780938 (TG)16 F: CAAGATGGACTACTCAAGG 3    247-252
Ppsm10 XII 12581231 (TG)7 F: GCTTAGTGTTAATTGGTTCCTG 7    218-232
Ppsm11 XII 15639505 (AT)8 F: AACAACGGTGCTATCTCCTCT 7    186-198
Ppsm12 XII 16027500 (TG)8 F: GCATGGTCATCATCTGGAG 4    251-263
Ppsm13 XII 16138995 (TG)13 F: GCCTGCTACAAAGCTGA 3    256-280
Ppsm14 XII 18276705 (CA)11 F: CCGATGGCCTGGTTCAC 47    263-445
Pprm1 III 4656850 (TG)15 F: TGTGCTGCAGACCTCCAC 5    202-214
Pprm2 IV 62968 (CA)13 F: GATACAGCTCCTGCTCCAG 4    163-169
Pprm3 IV 15800213 (GT)21 F: GGCTTCTATTTCTGCCTCCC 23    344-392
Pprm4 V 4991466 (TGT)6 F: GCTGGGCAGTATTCTGTGG 7    288-306
Pprm5 XV 21776 (AC)16 F: ATCCCAACGTCATCCAGCTC 2    193-194
Pprm6 XV 8323413 (CA)13 F: CTGGAGCGTTTACAGGTGG 8    364-382
Pprm7 XVI 3587216 (AC)10 F: CTGGAGACCAACAAGTTGAGG 12    274-298
Pprm8 XVIII 10203501 (GT)25 F: CACCCATGTTCCTGTGCTTC 11    306-380
Pprm9 XX 5366535 (CA)14 F: TCCTCATGATGTTGACCAGTGC 3    166-172
  1. LG, linkage group. F, forward; R, reverse. A, number of observed alleles.