Skip to main content

Table 5 Primers for PCR amplification

From: The Trypanosoma cruzi Sylvio X10 strain maxicircle sequence: the third musketeer

Primer name Primer sequence (5'-3') Binding site Tm MgCl2 Region amplified Product
    (°C) (mM)   (nt)
Tc. Sylvio.cons.Region.For1 TTGTAAAAACCTTATCAGCAAAGAAA Palindrome 46 3.5 Palindrome-partial 12S ~2,000
Tc. Maxi.12S.rRNA.Rev TTACTTGGTACATATATAACAACTG 12S     
Tc.CLBmaxi12s.For2 GCACAGTTGTTATATATGTAC 12S 50 2.5 partial 12S- partial 9S 1,528
Tc.Sylvio.Maxi9s.2R GATTACTGCACGTTATTTTTATT 9S     
Tc.9s.For.unedited GCCCACCAATTTTTATAATAA 9S 38 2.5 partial 9S-partial ND7 1,576
Tc.Maxi.ND8-Murf5.UTR.unedited.Rev ATCCTTCGAACATCCCTCCT ND7     
Tc.ND7.For.unedited CGGGAAGGAAGAACAGTT ND7 37 2.5 partial ND7-partial Cyb 2,161
Tc.Cyb.Rev.CDS.not edited CTAATCTAATCTACATACAAC Cyb     
Sylvio.Cyb.For.CDS.not edited GTTGTATGTAGATTAGATTAG Cyb 55 2.5 partial Cyb-partial ND1 2,773
Tc.CL Brener.NDI.CDS.Rev1 TTAATCTTATCAGGATTTGTTAGCC ND1     
Tc.CL Brener.NDI.CDS.For1 GGCTAACAAATCCTGATAAGATTAA ND1 50 3.5 partial ND1-partial COI 3,419
Tc.Maxi.4.Rev2 TTGCTTAAGTGTTTCCCACAAA COI     
Tc.Maxi.4.For TTTGTGGGAAACACTTAAGCAA COI 40 2.5 partial COI-partial ND5 2,283
Tc.Maxi.ND3-RPS12.Rev.2 TTGATTGTCAAAAACTTATAAAATGCC ND5     
Tc. maxiRPS12-ND5.unedited.For1 CCAACTTCCCTTCAAACCAA RPS12 50 2.5 partial RPS12-partial ND5 1,993
Tc.maxi.ND5.unedited.Rev1 TTCAAAATAACATAACAACATCCGTA ND5     
\