Skip to main content

Table 6 Internal primers

From: The Trypanosoma cruzi Sylvio X10 strain maxicircle sequence: the third musketeer

Primer name Primer sequence (5'-3') Binding site
99904 2-cons-12s F CACAAGTTGTTATGCATGTAA conserved region
99905 2-cons-12s R CTATCACAATTTGTGGGAAAA conserved region
83251 13-12S-9S F CGAAAATAAAATTTTAGTAGCATA 9S
6713 B-9S-ND7 4F GGTTGCCCTCTTGTTGTCAT ND9
1-42 CO3 CYB (R) CCTAAACTGAACCCCACTCC Cyb
1-43 CO3 CYB (R) CCTAAACTGAACCCCACTCC Cyb
1-69 CO3CyB (R ) CAAAAGCAAAGTCGCTCAC Cyb
1-68-CO3CyB (F) TTGGAGTTGGGTGGAGTTC ND7
55103 A Murf4-Cr3 R CGATTATCTCAGAAAGTGCCTTA ND1
64986 B-MURF4-CR3 3F GGCAATGGGAATTGTACCTA MURF1
6611 B-MRF4-CR3 2F CGGGCAACAACGGTTTTGA MURF4 (ATPase6)
69245 COII-CO1 Maxi Sylvio F1 ACCAATTTTGTATAACGCAATTATTA MURF2
894-17F 4-COII-COI F CGTATGCTTCTTAATATTATATTT MURF2
894-18 4-COII-COI R GCTTGATATAATGCTGCATGA COI
753-5 CO2-CO1 2F CGGTATCAATTTTTTGATATA MURF2
54597 CO2 CO1 2R CGAGCATTATAAATTCTATTAA COI
55799 CO2-CO1 F GTAGAGAACCGGGGAGGTGT COII
57799 CO2-CO1 R TTGCACCTGTTATGGTTGGAT COI
1-58-ND4CR4Bfor-M13F_B08 GGAGACTTTTTTACCAAGGG ND3
1-59-ND4CR4Brev-M13R_CO8 TCCCCCTTCTTCTCCTTCAC CR4
259-67 RPS12-ND5 F TGGCTAACCTTTTCATGTTCA ND5
256-66 RPS12-ND5 R CCTTGCAATAAAATCCACACAA ND5
\