Skip to main content

Table 2 Counts of the 21-24 nucleotides non-conserved miRNAs isolated from secondary xylem tissues of Am54 and Am48 and their potential targets predicted to be involved in lignin biosynthetic pathway.

From: Expression profile of small RNAs in Acacia mangium secondary xylem tissue with contrasting lignin content - potential regulatory sequences in monolignol biosynthetic pathway

Sequence ID Sequences
(5’ ➙ 3’)
Counts Am54 Counts Am48 Target genes
15212(24) AGAUGGUGAGGGAUCCAGGACUAU 17 18 Populus trichocarpa F-box family protein
13039(24) UGGACGUACUGAACAACAAUGAAG 25 20 Populus trichocarpa F-box family protein
278(21) UAAUCUGCAUCCUGAGGUAUA 281 286 Populus trichocarpa F-box
1045(24) GAGGACCGAGAUCAUAGAUGAAGA 121 104 Arabidopsis thaliana peroxidase, putative
666(21) UUCAUUGUCUGUUCGGCCCUG 67 121 Zea mays typical P-type R2R3 Myb protein
1391(21) UUUGGCAUUCUGUCCACCUCC 522 57 Populus trichocarpa f-box family protein, mRNA
2100(21) AAACGGGGUUGUGGGAGAGCA 15 36 Populus EST from mild drought-stressed leaves
2511(21) GAGCUCAUCUUAGGACACCUG 46 29 Populus EST from mild drought-stressed leaves
3079(211) AAGGUCGGCCAGUGAGACGAU 16 23 Populus EST from mild drought-stressed leaves
4169(21) GACUACAAUUCGGACGCCGGG 22 16 Populus EST from mild drought-stressed leaves
5876(21) ACGAUACUGUAGGGGAGGUCC 13 10 Populus EST from mild drought-stressed leaves
6077(21) AGCGUAGAUCCGGAGAUUCCC 16 10 Populus EST from mild drought-stressed leaves
166(22) GCCGGCCGGGGGAGGGACUGGG 150 127 Populus EST from mild drought-stressed leaves
297(22) GCCGUCCGGGGGACGGACUGGG 194 72 Populus EST from mild drought-stressed leaves
1182(22) GCCGGCCGGGGGACGGACUGCG 104 20 Populus EST from mild drought-stressed leaves
80(23) GAUGGAACAAUGUAGGCAAGGGA 89 158 Populus EST from mild drought-stressed leaves