Skip to main content

Table 3 List of the miRNA primers used in quantitative real time PCR analysis in compression wood and tension wood of 2 years old A. mangium.

From: Expression profile of small RNAs in Acacia mangium secondary xylem tissue with contrasting lignin content - potential regulatory sequences in monolignol biosynthetic pathway

Sequence ID Sequence ( 5’ ➙ 3’ ) miRNA family
87(21) TTTGGATTGAAGGGAGCTCTA amg-miR159
4(21) TCGCTTGGTGCAGGTCGGGAA amg-miR168
10(21) AGAATCTTGATGATGCTGCAG amg-miR172
622(21) TTGGCATTCTGTCCACCTCCC amg-miR394