Skip to main content

Table 4 Predicted Chlamydomonas reinhardtii miRNAs that are responsive to sulfur-deprivation

From: Characterization and differential expression of microRNAs elicited by sulfur deprivation in Chlamydomonas reinhardtii

Name Sequence (5'-3') L (nt) Location in the geonome MFE (kcal mol-1) Reads +S/-S
n006 UCCAGCUGGGCGGCCGUCUCC 21 chromosome_10:4733426:4733510:- -38.6 1004/2798
n015 UUCUACCCAAGAGGCUGUGUA 21 chromosome_12:2479175:2479337:+ -93.9 84/264
n030 UCAAAGCUAGGAGCCAUGAAG 21 chromosome_14:139326:139506:+ -129.4 1347/4625
n046 UGUUCGGAGAUCCUUGUGCAUG 22 chromosome_16:3072001:3072107:- -101.1 117/373
n051 UUGUUGACGACGUGCGCGGGC 21 chromosome_17:204043:204314:- -129.8 41137/86593
n052 UGACACAUGGAACAACACAAC 21 chromosome_1:3554627:3554814:+ -150.9 287/505
n062 UGACAUGCGGUGAAUGUGAAU 21 chromosome_3:5564702:5564806:+ -105.4 15185/49088
n077 UCAUGAAGCGGAUACUGUGAA 21 chromosome_7:743887:744064:- -103.91 1160/61
n083 UGGGCCUGUUGUGCACGUUCC 21 scaffold_28:208520:208678:- -115.9 104/662
n084 UUGUGCCGGCCGACACUGCGG 21 scaffold_33:45408:45519:+ -49.9 77092/55878
n152 UGUACGGCGACCUGCAAAUGG 21 chromosome_10:5980485:5980652:+ -115.7 0/215
n168 AGGAUGACCGUCAUGAUUGCG 21 chromosome_13:4630466:4630659:- -167 0/4628
n169 GUCAUUAAGACCGUCGGCAAU 21 chromosome_14:1815533:1815835:+ -206.26 0/170
n182 UAGGGCUUUUCGGAAGGGAGA 21 chromosome_17:4302900:4303054:+ -83.2 0/20463
n196 AUUCACAUUCACCGCAUGUCA 21 chromosome_3:5564693:5564816:+ -112 0/16257
n197 UCCUCCUCCUUGACGUCGGCG 21 chromosome_3:7309395:7309503:+ -50.1 0/321
n198 AGCAGCUUCCCACUCCCACGACC 23 chromosome_3:2104211:2104422:- -66.5 0/415
n200 UGCGCAGCGGCAUCAUCUGGA 21 chromosome_4:2994696:2994894:- -157.7 0/367
n207 UAGCAGUCUGAACCAAAGUCG 21 chromosome_7:2564607:2564734:+ -92.1 0/931
n209 UAUGGGCAGUUGUACUAAAUC 21 chromosome_7:4354369:4354571:+ -136.8 0/564
n212 UGGGCCUCACGGCGGCGGACC 21 chromosome_7:5449979:5450131:+ -140.8 0/270
n214 AGGGCCAACAGCUUUGACCGG 21 chromosome_7:5670376:5670487:+ -103.9 0/557
n222 AAUGCCAGCAGCUCCACGCCC 21 scaffold_18:257:618:+ -158.6 0/4384
  1. Name: the name of predicted Chlamydomonas reinhardtii miRNAs that are responsive to sulfur-deprivation; Sequence: sequence cloned in small RNA libraries; L, the length of miRNA; MFE: the adjusted minimum free energy (MFE) representing the MFE of 100 nucleotides; Reads: the effect of sulfur-deprivation on miRNA expression, +S/-S, normalized sequencing frequencies in the +S and -S library.