Skip to main content

Table 3 Primers used in this study

From: Altered expression of testis-specific genes, piRNAs, and transposons in the silkworm ovary masculinized by a W chromosome mutation

Name Seq. (5' to 3')
Male specific sperm protein-RT-Fw GCGAGAGGTGCTTATGGTTC
Male specific sperm protein-RT-Re GTCCATGGTGCGCATAAATA
Dynein-light-chain-RT-Fw GGTTTGGGCAAAAAGACAGA
Dynein-light-chain-RT-Re ATCTTTTGGTTTCGCCAGTG
Kendo-RT-Fw CAAACGTGCGCGCAAGTCCG
Kendo-RT-Re ATACGGTCGTCGTGCCGGAG
SART1-RT-Fw TCGCAGGCAGTTATTGTCAA
SART1-RT-Re GGCTAAAATCGATACGGCAGA
Taguchi-RT-Fw CCCTTTGCACTGACAAAGAG
Taguchi-RT-Re TGTGGGCGATGGACAGGCTT
trest1-RT-Fw TTGCGTCCACCGCTTCCTCC
trest1-RT-Re TGTGTTGAGACATTCCGCGG
Bmdsx-Fw AACCATGCCACCACTGATACCAAC
Bmdsx-Re GCACAACGAATACTGCTGCAATCG
\