Skip to main content

Table 1 Primers for qPCR

From: Genome-wide host responses against infectious laryngotracheitis virus vaccine infection in chicken embryo lung cells

GenBank Forward Primer Reverse Primer
AB109635 GGCACCAACTTGCTACCACA GCTGCAAGAGCTGCCATTAG
AF505881 CCAGCTACATCTCCCACCTG TCTGTTTGGGCTGGGAGTTC
BX932962 GTACAACCACGTTGGGCAGA CTCTCGCGTTTCCTTTGAGG
BX931297 TTGTGGCCTACCCCAGATGT GGATGGGACTTTCCAGAGCA
BX931599 CTGTTTCCTGACCGCAGTTC AGCACAAACTCCGCCATTTT
BX933478 CCTGTGCAAGGTGTCCAGTG CCCAATGGCCATACAGTTCA
BX933728 GCAAAGCACCATCCCAAATA TAT TGAGGCGCTGACTCCTG
BX933888 CTGGGATCCCTCCAGAGCTA CCATTCACTGGAGCACCAAA
BX935456 CGAGGCCATCAACTTCCTTC TCCACATGACGCACATACCC
BX936211 CCAGCTGTCCTCCTTGGAAT AGGGAGAGGAAGACGTGCTG
CR352775 GGCCTTGAATGACCATCATGT AACAGCAGCAGGAACAGTGC
CR385566 CGCGCTCTACGACTACATGC CTGGGTGGTGATCTCGGTCT
D87992 TGCAGCACTGAGACCTGGAT CAGTTGCTGCGGATGAAGTC
M60853 TTTTGGCTACCAGTCCAGCA TTCGCAAGTGTTCCCCAGTA
M64990 TGCTCCCCTGAGTACTGGAA GCCTCTGTGGGTTCAGGATT
M80584 TCCCACTGAGCAGCTTCTGTA CCAGAGAGATATCCGCAGCA
M87294 GGTGCTGACTTTCGCCTTGT GCCTGGTGATGAGGTTGATG
X87609 CCACCTGAGAAAAGCGACCT ACATCGACCTCTGCCAACCT