Skip to main content

Advertisement

Table 5 Polymorphic VNTR discovery found within a cell division gene (fts N) in S. Montevideo using NGS applications.

From: High resolution clustering of Salmonella enterica serovar Montevideo strains using a next-generation sequencing approach

160_Clinical_FL TGCGTTTGAGCCCACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
206_Clinical TGCGTTTGAGCCCA-----------------------------CTGCTGCTGCTGCTGCTGCTGCTGCGCCT
161_Clinical_1993 TGCGTTTGAGCCCA-----------------------------CTGCTGCTGCTGCTGCTGCTGCTGCGCCT
207_Sunflower TGCGTTTGAGCCCA-------------------------------------CTGCTGCTGCTGCTGCTGCGCCT
205_Soup TGCGTTTGAGCCCA-----------------------------------------CTGCTGCTGCTGCTGCGCCT
162_Reference TGCGTTTGAGCCCA-----------------------------------------CTGCTGCTGCTGCTGCGCCT
163_Clinical_GA TGCGTTTGAGCCCA-----------------------------------------CTGCTGCTGCTGCTGCGCCT
221_Clinical_NC_2 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
223_Clinical_NC_1 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
222_Clinical_NC_5 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
220_Clinical_NC_3 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
217_Drain_Swab TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
155_Clinical_NC_4 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
227_Pistachio_1 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
212_King Fish TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
204_Chicken TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
147_Black_Pepper3 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
148_Black_Pepper4 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
142_Pistachio_2 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
224_Clinical_OH_2 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
216_Black_Pepper2 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
215_Red_Pepper_2 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
158_Clinical_MD TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
225_Clinical_OH_1 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
228_Clinical_CT TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
229_Salami_2_CT TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
230_Salami_1_CT TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
233_Salami_CT TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
235_Salami_CT TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
214_Black_Pepper1 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
213_Sea_Trout TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
219_Red_Pepper_1 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
156_Clinical_OH_3 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
209_Romaine TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
237_Meat_IA_1 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
238_Meat_IA_3 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
239_Meat_IA_2 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
240_Meat_IA_4 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
242_Meat_IA_5 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
211_Perch TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
210_Mozzarella TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
236_Clinical_IA TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
157_Clinical_CA TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
144_Black_Pepper6 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
145_Black_Pepper5 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
146_Black_Pepper7 TGCGTTTGAGCCCA---------------CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCCT
  1. Terminal names correspond to samples in Table 1.