Skip to main content

Table 2 Summary of newly identified miRNAs

From: Characterization of microRNAs expression during maize seed development

miRNA Sequence Length Abundance Pre-miRNA Conservation
  (5’-3’) (nt) Seed Leaf Position1  
zma-miR01 AAAAAGCCAGAACGATTTATGA 22 15 - Intron  
zma-miR02a AAGCAAGGATAATGGAGGGGA 21 9 - Intron  
zma-miR02b AAGCAAGGATAATGGAGGGGA 21 9 - Intron  
zma-miR03 ACCGATCGGGAGAACCGGAGA 21 - 37 Overlap  
zma-miR04 ACGGTGTTGTGTCAGGGGGGT 21 6 - Intergenic  
zma-miR05 AGAACCGGAGAGCTAGAGGG 20 - 5 Overlap  
zma-miR06 AGAGGAGATTGAAGGGGCTAG 21 6 - Intergenic  
zma-miR07 AGAGGATCTATGGTGGAGGAA 21 5 - Intron  
zma-miR08 AGATATGGTAGAGGGGCCTAA 21 7 - Intergenic O. sativa
zma-miR09 AGCTATGAACGTCTGGATGCA 21 - 5 Intergenic  
zma-miR10 AGTGTTTGGTTAGATGGAATAG 22 - 26 Intergenic  
zma-miR11 ATACTAGGAGTGAAGGGATCA 21 8 - Intron  
zma-miR12 ATATATGTGGGTTGGGATTAAT 22 5 - Intron  
zma-miR13 ATCACAGGAGGATTGGAGGAG 21 9 - Intron  
zma-miR14a ATGGAGGGGATTGAGGGGCTA 21 - 9 Intergenic  
zma-miR14b ATGGAGGGGATTGAGGGGCTA 21 - 9 Intergenic  
zma-miR14c ATGGAGGGGATTGAGGGGCTA 21 - 9 Intergenic  
zma-miR15 ATGGTGCATTGACTTGGTCAA 21 - 5 Intron  
zma-miR16 ATTGTAGTGGATTGAGAGGGA 21 8 - Intergenic  
zma-miR17 ATTTTTGAAGGAAGGAAAGC 20 9 - Overlap S. bicolor
zma-miR18a CAAAGAGAATTGAGGGGGCTA 21 10 7 Intergenic  
zma-miR18b CAAAGAGAATTGAGGGGGCTA 21 - 7 Intergenic  
zma-miR18c CAAAGAGAATTGAGGGGGCTA 21 - 7 Intergenic  
zma-miR18d CAAAGAGAATTGAGGGGGCTA 21 10 7 Intergenic  
zma-miR19 CCAACAGGATATTGGGTATTTC 22 169 - Intergenic O. sativa
zma-miR20 CGCAGCGTTGATGAGCCAGCCG 22 57 7 Intergenic S. bicolor
zma-miR21 CGGCTCACCAGCGCTGCACTC 21 6 - Intergenic  
zma-miR22a CTGAAAAGTGTGGCGCGGTGT 21 - 9 Intergenic  
zma-miR22b CTGAAAAGTGTGGCGCGGTGT 21 - 9 Intergenic  
zma-miR23a GAGACAGACAACATATGTAGAA 22 - 26 Intron  
zma-miR23b GAGACAGACAACATATGTAGAA 22 5 - Intron  
zma-miR24 GAGCGCAGCGTTGATGAGCCAG 22 5 - Intergenic S. bicolor
zma-miR25 GGAGGAGATGGGAGTGGCTAA 21 12 - Intergenic S. bicolor
zma-miR26a GTCACAGAAGTTGGGATGCAA 21 5 - Intron S. bicolor
zma-miR26b GTCACAGAAGTTGGGATGTAA 21 - 13 Intron S. bicolor
zma-miR27a GTGATCACGGGAGATTGGAGA 21 - 7 Intergenic  
zma-miR27b GTGATCACGGGAGATTGGAGA 21 48 - Intergenic  
zma-miR28 TAGAGAGGATTAAAGTGGCTA 21 - 5 Intergenic  
zma-miR29 TAGCTCTTCCTGTTTGGATAT 21 5 - Intergenic S. bicolor
zma-miR30 TAGGGATCTATGGAGAGGAA 20 5 - Intergenic  
zma-miR31 TCAACACACGTGGATTGCGGT 21 - 6 Intron  
zma-miR32 TCACAAGGGGATTGAAGAGGA 21 5 - Intron  
zma-miR33 TCACTTTGGGATCACAGATAA 21 10 - Intron  
zma-miR34 TCAGAAAATATGAACTTGAGA 21 - 19 Intron  
zma-miR35 TCATAAGGGGATAAACAACGC 21 - 5 Intron  
zma-miR36 TCGGGGTTAGAGGGGATTGAG 21 6 - Intergenic O. sativa
zma-miR37 TGAAAAGCTAGAACGATTTAC 21 5 - Intron  
zma-miR38a TGAAGAGAATTGAGGGGGCTA 21 17 - Intergenic  
zma-miR38b TGAAGAGAATTGAGGGGGCTA 21 17 - Intron  
zma-miR39 TGGACAGGGAAATGAAGGGGA 21 16 - Intergenic  
zma-miR40 TGGAGGGGATTGAGGGGCATA 21 - 8 Intergenic  
zma-miR41 TTAGATGGGATACATGAGAGG 21 - 5 Intergenic  
zma-miR42 TTAGTAGTTTTAGTTCTTTGC 21 5 - Intergenic A. thaliana
zma-miR43 TTTAGTGATCAGCTGGAGGTT 21 - 5 Intron S. bicolor
  1. 1“Intron/Intergenic” indicates full-length of pre-miRNA localizes to that region, and “Overlap” indicates pre-miRNA overlaps with intron/exon or exon/intron (see Additional file 5).