Skip to main content

Table 7 U3 snoRNA genes in E. histolytica

From: Computational prediction and validation of C/D, H/ACA and Eh_U3 snoRNAs of Entamoeba histolytica

U3 snoRNA genes Len (nt) Seq (%) Scaffold Start End Homology Yeast/Human Location
A. U3 snoRNA genes
Eh_U3a 209 91% DS571856 3136 3344 snR17a/U3 U3 IR
Eh_U3b 225 92% DS571750 1819 1595 snR17a/U3 U3 IR
Eh_U3c 221 91% DS571479 13861 14081 snR17a/U3 U3 IR
Eh_U3d 221 91% DS571353 16563 16343 snR17a/U3 U3 IR
Eh_U3e 225 91% DS571336 2559 2783 snR17a/U3 U3 IR
B. Sequence of U3 snoRNA genes
Eh_U3a TAGACCGTACTCTTAGGATCATTTCTATAGTACAGTCAATCCATTATCCGTCTTAAAAATAACAACAAGACAATAGGATGAAGACTAAATAACCAACAACACCAACGGGAGATAAACAGTTGGAAACAAATGTACAATGAACGGCTTGAAACAATCTAAAGAAAGAAATTTCTAAAGATGGTTCAAGAGGTGAATGTTAGGGTGTCTGA
Eh_U3b TAGACCGTACTCTTAGGATCATTTCTATAGTACAGTCAATCCATTATCCGTCTTAAAAATAACAACAAGACAATAGGATGAAGACTAAATAACCAACAACACCAACGGGAGATAAACAGTTGGAAACAAATGTACAATGAACGGCTTGAAACAATCTAAAGAAAGAAATTTCCAAAGAAAGTTCAAGAGGTGATGTTAGGGTGTCTGACTATCTTTTTATGAAAT
Eh_U3c TAGACCGTACTCTTAGGATCATTTCTATAGTACAGTCAATCCATTATCCGTCTTAAAAATAACAACAAGACAATAGGATGAAGACTAAATAACCGACAGCACCAACGGGAGATAAACAGTTGGAAACAAATGTACAATGAACGGCTTGAAACAATCTAAGGAAAGAAATTTCCAAAGAAGGTTCAAGAGGTGATGTTAGGGTGTCTGACTATCTTTTTATG
Eh_U3d TAGACCGTACTCTTAGGATCATTTCTATAGTACAGTCAATCCATTATCCGTCTTAAAAATAACAACAAGACAATAGGATGAAGACTAAATAACCAACAACACCAACGGGAGATAAACAGTTGGAAACAAATGTACAATGAACGGCTTGAAACAATCTAAAGAAAGAAATTTCTAAAGATGGTTCAAGAGGTGATGTTAGGGTGTCTGACTATCTTTTTATG
Eh_U3e TAGACCGTACTCTTAGGATCATTTCTATAGTACAGTCAATCCATTATCCGTCTTAAAAATAACAACAAGACAATAGGATGAAGACTAAATAACCGACAGCACCAACGGGAGATAAACAGTTGGAAACAAATGTACAATGAACGGCTTGAAACAATCTAAGGAAAGAAAATTCTAAAGAAGGTTCAAGAGGTGATGTTAGGGTGTCTGACTATATTTTTACGAAAT
  1. Note: “Len.” denotes length of the snoRNA genes; “Seq.” is sequence identity of corresponding snoRNA genes in E. dispar and “IR”, intergenic region.