Skip to main content

Table 3 QPCR Primers

From: A moderate increase in ambient temperature modulates the Atlantic cod (Gadus morhua) spleen transcriptome response to intraperitoneal viral mimic injection

Gene   Primer sequence 5’ to 3’ Amplification Efficiency (%) R2 Amplicon Size (bp)
Deltex3b Forward TCCACCACAAGACCAGCATCA 98.5 0.99 110
Reverse ACTTCACTCGATGCCTTTCGC
DHX58c Forward ACAGAAGCCATCGCAGAAAT 92.9 0.99 105
Reverse TTTTGCAGCACGAATCAAAC
IκBαc Forward GCCAGCAACTGATAAAGCATC 92.1 0.99 132
Reverse GGTCACAGAGGGAGACAGAAAA
IL-8c Forward GTGTTTCCAGCAGATCACTCG 94.9 0.99 118
Reverse TGTTCCACTTGGTGAGGAGTC
IRAK4c Forward CGTGGATTACAAGATGGATAAGC 95.8 0.99 102
Reverse TCGTCGGGGTCTAAAAAGTC
IRF1a Forward AGAAGGACGCCAGTCTGTTCAA 88.5 0.99 100
Reverse GCGGAAGTTGGCTTTCCATT
IRF7a Forward GGTCGTCGGAGTTCTTGGAGTT 95.1 0.99 102
Reverse CCAAACGACAAGGCCAAATG
IRF10a Forward CGAGGCGGTAGACCTTGTAG 104.6 0.94 161
Reverse GGGCAGGTACAAAGGGAAAT
ISG15c Forward AGGACCAACAAAGGCTGATG 94.7 0.99 110
Reverse CAGCCGTCCGTTAAGGTAGA
PKRc Forward ATTGCATCAGGTTCCCAATC 94.4 0.99 174
Reverse GCCGTTACCAGACCAAAATC
RSAD2c Forward TGTTTCCACACAGCGAAGAC 95.8 0.99 108
Reverse TCCGCCAGAGAAGTTGATCT
SACSb Forward CTCCCACTGCCAATGTCATTC 88.5 0.99 102
Reverse TCAAGAAAACGTCCCAAGGC
SCYA123c Forward GCTCTGGGTCGTGTACCTCT 94.1 1.00 189
Reverse TCTCTCTGGACGAACAAGCA
STAT1b Forward GCCAATGCCATGTGTTTATG 97.5 0.99 100
Reverse ACCTGGAGCAGTTCGTCAGT
TLR3c Forward CCTGAAACGCAACTCTATCTCC 90.6 0.99 121
Reverse GCCATCAAACATACCCTTCTTT
TLR9c Forward TTGCTCGCCAAAACACTATG 99.5 0.99 150
Reverse GGAATCCAGTCCCTCTCCTC
ZNFX1b Forward ATGCCACTATCGGTGGACAGA 87.3 0.99 108
Reverse TCAACAGATTATTGCCCTCGG
ATPSc Forward ACATGGATAAATGGCTTTTTGC 99.6 0.98 155
  Reverse TTGAAGAAGTAGTGTGGCTGGA    
  1. aThese primers were previously designed and used in Rise et al.[22] but were still quality checked for the present experiment using the reference cDNA as template.
  2. bThese primers were previously designed and used in Rise et al.[25] but were still quality checked for the present experiment using the reference cDNA as template.
  3. cThese primers were designed based on ESTs or contigs representing probes that were identified as differentially expressed in the microarray experiment.