Skip to main content

Table 2 Quantitative PCR specifics

From: Microarray gene expression profiles from mature gonad tissues of Atlantic bluefin tuna, Thunnus thynnus in the Gulf of Mexico

Putative Gene Annotation Microarray identifier EST Accession No. Sequence (5-3)# Amplicon length (bp) Amplification Efficiency (%)
ZPC1 TTC00305 EC091965 F – CATACCACCCTTCACCCATC 212 102
R – GCTCCACACTAGCCCATGAT
Vitelline egg envelope gamma TTC00056 EC091692 F – GCTTGCATGTGTCAGGCTTA 198 94
R – GGAGAATGGCTTGACTGCTC
Aveolin TTC00935 EC092671 F – GCTTCTGCTGCTCTTCGTCT 198 90
R – AACAACACCTGAGGCAGGAC
Choriogenin L TTC04136 EG630294 F – GAGCAGTCAAGCCATTCTCC 230 94
R – CGTCAATCTCAGTGGCTGAA
Cathepsin S TTC00230 EC091881 F – GGATCGACACTGGGAACTGT 297 92
R – CCCTCCAGTCCAGTGATTGT
Aquaporin 1 TTC00180 EC091829 F – CCTGTTTCGCAGTCTTGGAT 191 96
R – GGTCGGGGTAGGAATCATTT
Tmc6-related protein 1 TTC04625 EG630885 F – CCGGTTTCTCCTCACCAATA 135 91
R – TTGTGCGTGACATTCCTGAT
Fatty acid-binding protein, adipocyte TTC00964 EC092703 F – ACTGCAATGACCGAAAGACC 175 97
R – CCTCCTTTCCGTAGGTCCTC
Epididymal secretory protein E1 precursor TTC00209 EC091860 F – GCTTGATGGGATTCACCTGT 215 94
R – CGATTATTCCCATGGACCAC
Synaptonemal complex protein 3 TTC02745 EC918114 F – AAGAGCTGAGCGGTTCAGAG 264 91
R – TGACCGTGGTAGTTGTTCCA
T-complex-associated testis-expressed protein 1 TTC02749 EC918118 F – TGCTGGTGAAACACCTCTTG 208 92
R – AGGGACAAAAGGGTGGAGTT
Brain-type fatty acid binding protein TTC05153 EG999669 F – CCTACACCTGATGACCGACA 212 98
R – GCTGGGATGATTTGCTCATT
Intestinal fatty acid-binding protein TTC05128 EG999641 F – CGCAGCGAGAATTATGACAA 244 95
R – AGCATGTCACCCTCCATCTC
  1. #F refers to the forward primer while R indicates the reverse primer.