Skip to main content


Table 3 Novel miRNAs identified in alpaca skin

From: Identification and characterization of microRNAs in white and brown alpaca skin

Name Sequence MFEI
Alpaca-novel-82 TCGCTCTCCTGCTCGCTCTGC 0.9789
Alpaca-novel-37 TGTTTCTCAGAAGACTGTAGT 1.0155
Alpaca-novel-17 TGAACGGGGCCCTTCTGGTAG 1.0246
Alpaca-novel-31 ATTGGCATGTCCTGGAATGAG 1.0554
Alpaca-novel-53 CCAAACCAGTTGTGCCTGTAG 1.0602
Alpaca-novel-81 ATTGATCTTTGACTATAACTG 2.0412
  1. MFEI, MFE index.