Skip to main content


Table 2 Characteristics of 94 polymorphic SSR markers developed in Vicia faba L. (F=forward primer, R=reverse primer, Size = size of cloned allele, Ta = annealing temperature)

From: High-throughput novel microsatellite marker of faba bean via next generation sequencing

Primer Repeat F (5’– 3’) R (5’– 3’) Size (bp) Ta(°C)
CAAS13 (CAA)11aaatcccaaaaactgcaaattgtatgccatcttaaaccatac(CAA)7 CAAAAATCCCAAAAACTGCAA TCGATTTTTCGACTTGGGTC 130 56