Skip to main content

Table 5 MiRNA isoforms from P.vulgaris

From: Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing

Variant
group
Reference
miRNA
Sequence (5'- 3') Length (nt) Reads
     LL FL RL SL Total
Length variants gma-miR1511 AACCAGGCTCTGATACCATG 20 978 625 449 1529 3581
  pvu-isomiR 1511 AACCAGGCTCTGATACCATGA 21 14902 13725 7707 17239 53573
  gso-miR482a TCTTCCCTACACCTCCCATAC 21 7 318 85 2 412
  pvu-isomiR 482a TCTTCCCTACACCTCCCATACC 22 369 17616 5564 305 23854
  mtr-miR171c TGATTGAGCCGTGCCAATATT 21 0 0 0 0 0
  pvu-isomiR 171a TGATTGAGCCGTGCCAATA 19 115 1390 60 57 1622
  pvu-miR482* GGAATGGGCTGATTGGGAAGCA 22 1185 6 440 10 1641
  pvu-isomiR 482* GGAATGGGCTGATTGGGAAGC 21 714044 3806 173153 1 1207244
  pvu-miR159a.2 CTTCCATATCTGGGGAGCTTC 21 1 0 0 0 1
  pvu-isomiR 159a CTTCCATATCTGGGGAGCT 19 13 263 157 23 456
  gma-miR4376 TACGCAGGAGAGATGACGCTGT 22 1 1 0 0 2
  pvu-isomiR 4376 TACGCAGGAGAGATGACGCTG 21 3841 1090 0 398 5329
  mtr-miR171b TGATTGAGCCGCGTCAATATC 21 0 0 0 0 0
  pvu-isomiR171b TC TGATTGAGCCGCGTCAATA 21 101 1 79 10 191
Non conserved variants ath-miR858 TTTCGTTGTCTGTTCGACCTT 21 0 0 0 0 0
  pvu-isomiR 858 C TCGTTGTCTGTTCGACCTTG 21 37 351 0 26 414
  csi-miR479 TGTGATATTGGTTCGGCTCATC 22 0 0 0 0 0
  pvu-isomiR479 TGTGATATTGGTTT GGCTCA 20 58 1 1588 11 1658
  gma-miR1510a-3p TTGTTGTTTTACCTATTCCACC 22 0 0 0 0 0
  pvu-isomiR1510a TGTTGTTTTT CCTATTCCACC 21 463 877 902 28 2270
  gma-miR1510b TGTTGTTTTACCTATTCCACC 21 0 0 4 0 4
  pvu-isomiR1510b TTGTTTTT CCTATTCCACCAA 21 3313 17893 8413 222 29841
  mtr-miR2199 TGATACACTAGCACGGATCAC 21 8 0 0 0 8
  pvu-isomiR 2199a TGATACACTAGCACGGG TCAC 21 16 1323 799 59 2197
  pvu-isomiR 2199b TGATACACTAGT ACGGATCAC 21 2586 0 0 5 2591
  mtr-miR2597 TTTGGTACTTCGTCGATTTGA 21 0 0 0 0 0
  pvu-isomiR2597 TTTGGTACTTCC TT GATTTGA 21 0 22 253 0 275
  ppt-miR894 CGTTTCACGTCGGGTTCACC 20 1 3 1 0 5
  pvu-isomiR894 CGTTTCACGTCA GGTTCACCA 21 15 6 0 0 21
  pta-miR1310 GGCATCGGGGGCGTAACGCCCCT 23 0 0 0 0 0
  pvu-isomiR1310 GGCATCGGGGGCGC AACGCCC 21 33 5 0 0 38
Conserved variants ctr-miR166a TCGGACCAGGCTTCATTCCCCC 22 2 18 10 10 40
  pvu-isomiR166a TCGGACCAGGCTTCC TTCCCC 21 113 371 241 63 788
  osa-miR156l CGACAGAAGAGAGTGAGCATA 21 0 0 0 0 0
  pvu-isomiR 156a T GACAGAAGAGAGTGAGCA 19 2682 7 334 222 3245
  mtr-miR164d TGGAGAAGCAGGGCACATGCT 21 0 0 0 0 0
  pvu-isomiR164a TGGAGAAGCAGGA CACATGC 20 58 64 535 12 669
  vvi-miR156e TGACAGAGGAGAGTGAGCAC 20 30 0 1 1 32
  pvu-isomiR 156b TGACAGAC GAGAGTGAGCAC 20 261 0 2 2 265
  csi-miR393 ATCCAAAGGGATCGCATTGATC 22 1 0 0 0 1
  pvu-isomiR393 T TCCAAAGGGATCGCATTGA 20 911 581 667 4 2163
  ctr-miR171 TTGAGCCGCGTCAATATCTCC 21 0 0 0 0 0
  pvu-isomiR171c TTGAGCCGCGTCAATATCTCA 21 30 151 129 58 368
  mtr-miR169p TGAGCCAGGATGGCTTGCCGG 21 0 0 0 0 0
  pvu-isomiR169a TGAGCCG GGATGGCTTGCCGG 21 2 228 26 97 353
  ptc-miR396f TTCCACGGCTTTCTTGAACTG 21 0 11 4 1 16
  pvu-isomiR396a TTCCACC GCTTTCTTGAACTG 21 11 10 3 0 24
  zma-miR398a TGTGTTCTCAGGTCGCCCCCG 21 2 0 2 0 4
  pvu-isomiR398a TGTGTTCTCAGGC CGCCCCT G 21 21 0 18 0 39
  sly-miR171c TATTGGTGCGGTTCAATGAGA 21 0 0 0 0 0
  pvu-isomiR171d TATTGGTC CGGTTCAATGAGA 21 353 386 0 192 931
  1. Phaseolus vulgaris miRNA isoforms were classified as length variants, non-conserved miRNA variants, or conserved miRNA variants. Variants were named with the prefix pvu-isomiR followed by the miRNA family number of the reference miRNA. Underlined bases denote differences in length and/or composition of bases between variants and reference miRNAs.