Skip to main content

Advertisement

Table 1 The sequences of M-TR motif in 20 individuals of P. cornutus

From: Pause-melting misalignment: a novel model for the birth and motif indel of tandem repeats in the mitochondrial genome

Individuals Sequences
18 specimens TTTATAACACTATTTATCAAAATACTCAAATTT GTGGTGCCCAGGATATTTAGAACACTTTAATG*
DS-03 (TTTAAAACACTATTTATCAAAATACTCAAATTT GTGGTGCCCAGGATATTTAGAACAC)2TTTAATG
QD-07 TTTGT(AACACTATTTATCAAAATACTCAAATTT GTGGTGCCCAGGATATTTAG)4,5AACACTTTAATG
  1. *The sequences in 18 specimens are not repeated. Bold font: The bases at the 5′end of the repeat and bases identifying the 3′ flanking region.