Skip to main content

Table 1 List of genes selected for differential expression analysis and the oligonucleotides used in this study

From: Identification of differentially expressed genes from Trichoderma harzianum during growth on cell wall of Fusarium solanias a tool for biotechnological application

Putative function Accessionnumber E-Value Protein ID* qPCR forward (F) and reverse (R) primers (5' to 3')
acid sphingomielinase (asm) JK840922 1.39E-136 548323 Forward: GCGAAGCATCTCGGCTATTGTAGT
Reverse: TCAAGTTGTGAACCGCTACTCGTC
β-1,3-endoglucanase (bgn) JK840920 8.92E-21 241696 Forward: TCAACATCGCCAACGTCAACGAC
Reverse: TGCCAATACGGGAACCAGTGATC
chitinase 33 (chit) JK840912 3e-51 387920 Forward: TGGAGCTCAACAGGCGCTGC
Reverse: ACGACGGCACTGCCAAAGGG
endochitinase 42 (endo) JK840909 3.0E-46 364419 Forward: AAGGGTTACTACAGCTACAACGCC
Reverse: ACTTGAGGTAGGCAACCTTGGTGT
exo-rhamnogalacturonase (exo) JK840947 2.12E-65 463001 Forward: TTACCTGAAGACATGGGCGGGAAT
Reverse: GCCTTCCGCCAATCAGCTTAACAT
glycosyl hydrolase (glyc) JK840945 1.51E-09 199282 Forward: GAAATGTTGTCGTCACCAGACGGT
Reverse: GGCCGCGATTGCTGTTTCATAGT
amine oxidase (aoc) JK840953 9.50E-15 538657 Forward: ATACACCCGAAGGAACCTTGTTGG
Reverse: TAGCGTGCCTCAATCTCCTTAGCA
phospholipase d (pld) JK840907 3.58E-56 537712 Forward: TGGGAAGACGTTGCACACACAAAC
Reverse: AAATTGTCGTAGTCGTCCCAGGTG
checkpoint-like protein (chk1) JK840936 2.48E-14 NA Forward: TGCTGCCTTCCTTGGATGTAGTAG
Reverse: AAACATGGTGGCAACGGGTAACG
serine threonine-protein kinase (sck1) JK840919 1.15E-80 480202 Forward: ATGCTGAAGAGCTTAAACGCCACC
Reverse: ACTTTGGCTTGAAGGGTGGAGAG
senescence-associated protein (sag) JK840934 5.02E-30 547464 Forward: AGCTCACGTTCCCTATTAGTGGGT
Reverse: ATCCTTCGATGTCGGCTCTTCCTA
mbl2-like secreted (mbl2) JK840948 2.05E-41 257052 Forward: TTGCTACGAGGGAGTTTGTTCCTG
Reverse: TGGAGTTGCACTGGTCTGAAGT
serine protease (ser) JK840930 1.54E-12 366985 Forward: TGGAAGGGAGTGACCAAGCCTG
Reverse: GGAAAGGTCAGGAGTGCTATCGGG
aquaporin (aqp) JK840978 1.47E-60 476226 Forward: GTTGATGGCATAACCAGTCTCCCA
Reverse: CAACAACATTGGAGCCGGAAACCT
duf895 domain membrane protein (duf) JK8409133 1.67E-92 396055 Forward: TCCAATCCTTGCCGACGTAGTTGA
Reverse: TGCCAAGATCACATGGGTCGTTCT
peptide transporter (ptr2) JK840963 8.11e-74 533699 Forward: AGTCATCTGGTTGTAGGCCAGGAA
Reverse: AAATTGTCGTAGTCGTCCCAGGTG
QID74 protein (qid) JK840906 6.31E-113 456637 Forward: CAGAAGAAGTGCGTGTGCAACAAG
Reverse: AGCTAGCATCTTTGCCGCAGTTTG
eight cysteine-containing domain (cfem) JK840940 1.09E-17 245062 Forward: GCGTCCGCAAAGAAACAACCTTCT
Reverse: AGAGAGCGGTGTTTGTAGCGATGA
Enolase (eno) JK841017 3.54E-12 315824 Forward: ACTTTGACCGAGTCTATCCAGGCT
Reverse: ATACCGACGGAGATGTCAGCAATG
glyceraldehyde 3- phosphate dehydrogenase (gapd) JK840981 1.32E-32 281265 Forward: CAGGTCGCCAAGAAGGTCATCATT
Reverse: AAGCGTTGGAGATGACATTGGCAC
pyruvate decarboxylase (pdc) JK840980 2.60E-31 277935 Forward: GCAGGTGTTGGTCAATTCCTTCAG
Reverse: AACGCCAGATGGGAACTTGGTATC
heat shock protein (hsp98) JK841007 9.91E-13 225475 Forward: TTGAGCGTCGTTTCCAACAGGTTC
Reverse: TGTCGAGAATGCTGACCTTGTGGT
zinc finger domain protein (c2h2) JK841004 1.67E-15 543717 Forward: CAGACCTTGCACTTGTGCTTCTT
Reverse: AATGTTGTCGACCTCACTGCCT
hexose transporter-like protein (ht) JK840987 1.20E-35 360713 Forward: GGAGTCCCATTTGCTCGAAGTGAT
Reverse: CGTGCTCATCGTCTTCTT CTTCGT
zinc-regulated transporter (zt) JK840990 3.84E-15 295941 Forward: GGCCAAGAAATCCAGCAGGAAGAT
Reverse: TTGACTAGTGGCTGGGCTGAATAC
norsolorinic acid reductase (norA) JK841015 6.41E-37 373869 Forward: ACCGTCTCGTCAACATGAGCTACT
Reverse: AAGTTCATGGAACCCAAGCACAGC
phosphatidylserine decarboxylase family protein (psd) JK840982 4.91E-23 363281 Forward: TCTTTGAAGGCGTAGGTGATCCGA
Reverse: GCAGATCCGTAGAGGCAAGTATGT
coproporphyrinogen oxidase (cpox) JK841003 4.88E-24 364552 Forward: TGATCCAGGCGTGTTCAGTCCAAA
Reverse: GCAGATCCGTAGAGGCAAGTATGT
α-tubulin HS574101    Forward: TATCTGCTACCAGGCTCCCGAGAA
     Reverse: TGGTGTTGGACAGCATGCAGACAG
  1. * BLASTX at http://genome.jgi.doe.gov/ using Trichoderma harzianum CBS 226.95 as a reference model.