Skip to main content

Table 4 List of primers used for the Real-Time PCR analysis

From: Effects of salinity on the transcriptome of growing maize leaf cells point at cell-age specificity in the involvement of the antioxidative response in cell growth restriction

Gene name GI Forward primer 5-3 Reverse primer 5-3
Actin 99030435 TGCTGAGCGAGAAATTGTCAGGG TTCCATGCCAATGAAGGATGGCT
APX 600115 ATCGCCGAGAAGAATTGCG GGTTCTTCATGGTGCCGAA
PPi 195610705 GAGCTCTCGTTGGCCTGATTT ACGAAGAAGCATGGTCACAGC
V-PPi 238011099 GTGTTGCAATTGGTCTGTGG CTGCAAGAATCTGCAACGTC
pDIR9 226498795 CCACTTCTTCTTCCACGACAC TCCATCACGTTCACCATCC
PPIase 226500875 AGCTTTGCACCAAGGTTCTG TCAGGATCGATTTCCAGTGC
IcoA DH 195642911 ATGTCGTCAGCATGAAGTGC CGTAAACAACCAGTGTCTGAGC
  1. Inorganic pyrophosphate (PPi), vacuolar inorganic pyrophosphate (V-PPi), ascorbate peroxidase (APX), isovaleryl-CoA dehydrogenase (ICoA DH), peptidyl-prolyl isomerase (PPIase).