Skip to main content

Table 3 List of primers used for PCR amplification of DYZ1 array (A) and SRY gene (B)

From: Fate of the human Y chromosome linked genes and loci in prostate cancer cell lines DU145 and LNCaP

(A)
Serial No. Primer ID Primer Sequence Length (bp) Location (DYZ1 array) Orientation
1 SAS 1 CCATTCGAGACCGTAGCAAT 20 35-16 (5’ upstream to HaeIII site) 5’-3’
2 SAS 2 TTTCCTTTCGCTTGCATTCCAT 22 63-84 5’-3’
3 SAS 3 ATTTGATGCCATCCCATGAC 20 763-782 5’-3’
4 SAS 4 TTTTGAGTCCGTTCCATAACAC 22 1380-1401 5’-3’
5 SAS 5 TCCTTTGCCTTCCATTCG 18 1668-1685 5’-3’
6 SAS 6 TGCAGTCTTTTCCCTTCGAG 20 2564-2583 5’-3’
7 SAS 7 ATTGGATGGGATTGGAATGA 20 861-880 3’-5’
8 SAS 8 TGGATGGACTGCAATAGAAAG 22 1600-1621 3’-5’
9 SAS 9 TCGAATGGAAGGCAAAGG 18 1669-1686 3’-5’
10 SAS 10 CGACTGGTACGGACTCCAAT 20 2637-2656 3’-5’
11 SAS 11 GACTGGAAAGGCTGGGTGTCGA 22 3419-3440 3’-5’
12 SAS 12 TGGACAGCCTGGAATAAAGTG 21 3586-3606 3’-5’
(B)
1 SA 531 GAATCTGGTAGAAGTGAGTTTTGGA 25 61-85 5’-3’
2 SA 532 GCCTTTATTAGCCAGAGAAAAGAAA 25 860-884 3’-5’