Skip to main content

Table 5 Features of sRNAs associated with fungal genes down-regulated during infection

From: Physiological stressors and invasive plant infections alter the small RNA transcriptome of the rice blast fungus, Magnaporthe oryzae

Gene ID/Description sRNAa Microarrayb Signature Chromosome Origin LMg72c LMg96 c
MGG_02390.7 conserved hypothetical protein 14.91 -1.31 GCAGGCAGAGGAACACTGAAGCA 1 3’UTR sense 287 0
MGG_06609.7 acetyl-CoA hydrolase 17.18 -1.37 CAAGGAGAGGATTCTGTTGCGATCGCAGT 4 Exon sense 790 0
MGG_09965.7 conserved hypothetical protein 0.00 -1.80 GAACAGGGCTGGCTTGCCTGACAAC 4 5’UTR sense 503 0
MGG_08843.7 magnesium transporter ALR2 36.75 -3.30 GATGACTTGGAAGTATGAAGCCAGCGTGATGG 2 5’UTR antisense 395 0
MGG_04696.7    CGGTTGGACAGAGTATTCGGCA 2 3’UTR sense 0 175
MGG_01991.7 betaine aldehyde dehydrogenase 12.55 -1.75 CAGTGGTCTCGGCACTGAGAACGGT 1 Exon sense 180 0
MGG_06868.7 acetolactate synthase catalytic subunit 10.42 -2.02 GTGGAAGGAGAAGTGGCCTCTGTCACA 1 Exon sense 287 0
MGG_04428.7 zinc finger transcription factor ace1 28.29 -2.11 CATGGCTCGCCGCAAGAAGAACG 2 Exon sense 180 0
MGG_01596.7 DNA damage response protein kinase DUN1 18.67 -3.00 CAGGCAAGGGCAAGGAACACT 2 Exon sense 251 0
MGG_04994.7    CGACTCTGACGACGAGGATGGAAC 3 Exon sense 0 237
MGG_09395.7    has Tandem repeats on it 6    
  1. a Ratio of sRNA between rice library and CM library based on cluster data.
  2. b Expression of genes at 72hpi in rice compared to CM using microarray data [29].
  3. c Abundance of signature.