Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 4 Details of the oligonucleotides used for the quantitative RT-PCR analysis

From: Escherichia coli- and Staphylococcus aureus-induced mastitis differentially modulate transcriptional responses in neighbouring uninfected bovine mammary gland quarters

Gene Gene Symbol Direction Sequence (5′-3′) Product size
ATP-binding cassette, sub-family G ABCG2 F CCTTCGGCTTCCAACAACT 129
B-cell translocation gene 1, anti- BTG1 F TGAAAGTAGCAAGTGACCAGAA 192
Chemokine (C-X-C motif) ligand 2 CXCL2 F GCCAAACCGAAGTCATAGCC 213
Chemokine (C-X-C motif) ligand 12 CXCL12 F TTGAAAGCCTGACCCATAAA 146
FK506 binding protein 5 FKBP5 F CCACAGCAGCATCACACAC 189
Frequently rearranged in advanced T- FRAT1 F GCCCAAAGGACAAGGATG 186
Isocitrate dehydrogenase 1 (NADP+), IDH1 F CTCTCAAGGGTAAAGGCAAA 113
Lipopolysaccharide binding protein LBP F AGGGCAAGGTGAAAGACAGG 178
Mannosyl (alpha-1,3-)-glycoprotein beta- MGAT1 F TCTCCATCCAGTCCTTTCCA 191
1,2-N-acetylglucosaminyltransferase   R ACATTGCTCTCCAACCCATC  
S100 calcium binding protein A8 S100A8 F TCTATTTTGGGGAGACCTGGTG 203
S100 calcium binding protein A12 S100A12 F AGGGAATCATCAACATCTTCCAC 172
Transforming growth factor, beta 1 TGFB1 F AATGGTGGAATACGGCAACA 121
Xanthine dehydrogenase XDH F TCAGGATGATGGTTGGAAGA 193
Chromosome alignment maintaining CHAMP1 F AGCAGTGACCAAGAGCAGGT 205
phosphoprotein 1   R TCATAGCACGACAGCAACAA  
  1. F and R denote forward and reverse primers respectively.