Skip to main content

Table 1 Primers used for detecting allelic variation in TaOPR1-A, TaOPR2-A, TaOPR7-B, TaLOX1-A, TaLOX2-B, TaSrk, TaClp , and TaPkc in hexaploid wheat

From: Genetic association of OPRgenes with resistance to Hessian fly in hexaploid wheat

Primer Sequence (5′-3′) Loci PCR size (bp) T m (°C) Restriction site
OPRC1-ABD-F2 CCGTCGACGCCGGTACG TaOPR1-A 337 62 Kpnl
OPRC1-R8 GGCCGCCGATCTCCCT TaOPR1-A    
OPR22-C1-F3 TCTGCTTTCCTCTGCTCGTC TaOPR2-A 634 55 Hincll
OPR-R2 TTCATGGTTCAATGACACATCAAGG TaOPR2-A    
OP1-C1F1 AAAAGGTTTTCACCTCGATGATCGGGG TaOPR7-B 487 55 Ddel
OP1-R1 CCGATGGCCCTGCACCTCGTCATCG TaOPR7-B    
LOX-C5-F5 CATCCTGAATAAAGAACCTC TaLOX1-A 2500a 55 ScrFl
LOX-C5-R6 GATCATATGGAGACGCTGTT TaLOX1-A    
LOX0-F4 GGAGCACGGCCTCAAGCTC TaLOX2-B 680a 52b dominant band
LOX0-R6 CATGTGGTTTATTTTAGCTCTGTAGA TaLOX2-B    
LOX-F4 CTGCGTCGAGCCCTACATCATCG TaLOX6-B 264/272 62 8-bp indels
LOX-R6 GGGCCAGCCCCCGGCTGACG TaLOX6-B    
Srk-F3 CGGACCACTTCAACCATAGG TaSrk 1437 56  
Srk-R2 ACCTTTCACAGTCTGCAATGGCAATGCT TaSrk    
CLP-F1 TCCATCTCCTATGGCTTCTT TaClp 1648 55 Rsal
CLP-R2 GGTGGGGGTTGCCTATCCAG TaClp    
Pkc-F3 GAGAGAAGCAATTCAGGGCT TaPkc 911 55  
Pkc-R2 CCAGATTACAATTTTAAAGAGAAG TaPkc    
  1. a Estimated product size.
  2. b A touch-down program (60°C down to 52°C for annealing temperature) was performed before the regular was performed (see details in Methods).
\