Skip to main content

Table 1 Candidate genes mapped in a white clover F 1 population

From: An integrated genetic linkage map for white clover (Trifolium repens L.) with alignment to Medicago

T repens Locus Annotation Intron Tr LG Mt PM Ref Forward Primer (5'-3') Reverse Primer (5'-3')
TrPHR MYB transcription factor 1 2-2 2 [36] GTTGATGCTGTGGCTCAACTT CCCATAACTCTGAGGACCCCT
  Phosphorus transport      
TrCPS Glutamine synthase 2 3-1 3 [37] TGGATCAGGTTTGGACTTGAG GGAAGCTGTGAAGGGTCAGTA
  In planta nitrogen cycling      
TrMIP Myo inositiol 1-P- synthase 9 3-1 3 [38] GTTATCTGACCAAGGCTCCTCTG ACCACTGGTGTGCCCGGTGGAAC
  Pinitol synthesis      
TrLFY LEAFY 1 3-2 3 [39] TCTCGATGCTCTCTCTCAAGAAG TCGCTGCACCACCGGCTCCTCCG
  Flowering      
TrPLT1 PLETHORA 6 4-2 4 [40] GTGAGCTTCATACCTTCCAGTCC AAGAACTTCGATATATCGCGGTG
  Root growth      
TrSHP - 2 SHATTERPROOF9 2 4-2 4 [41] GAGGTACAAGAAAGCATGTTCAG CTTCAAGTATTCACGGTAACTGC
  Dehiscence      
TrSHP - 8 SHATTERPROOF9 9 4-2 4 [41] AAAGCATGTTCAGATTCTTCTGG GCAGTTTGGCAGCTTCTTGCTGG
  Dehiscence      
TrPRP ROOT PHOTOTROPISM2 3 5-2 5 [42] AATCGACGATGATCTTTACCGCGCCG TTTGTTCTGTGACGCGTGCACACG
  Root growth      
TrDFR Dihydroflavonol reductase (DFR) 1 6-1 2 [43] CATTGGAAGAGTTAGAGATTTAG TCCAACTTCCATAAATGTTCAAC
  Condensed Tannin      
TrIAA SOLITARY ROOT 4 6-1 2 [44] TGAAAGGCTCTGATGCAATTGGG CTAGATTTTTCCATTGCTCTTGG
  Root growth      
TrSEP1 SEPELLATA1 2 7-1 7 [45] GCAAACCTGCTAAAGAACTTGAG CTTCAAGTATTCACGGTAACTGC
  Floral initiation      
TrTT12 TRANSPARENT TESTA12 3 7-1 7 [46] CAGATCCAAAGTTGGAGACATCGG AGCCCATAGGATATGGTGAAGTGC
  Condensed Tannin      
TrRMS5 RAMOSUS5 6 7-2 7 [47] GGCGAAGAAGAAGATGATGG CATCTCTGCATTGAGGTAGCA
  Branching      
TrAlaAT ACC SYNTHASE1 6 8-2 8 [48] AACTGGTGCCTATAGTCATAGTC GCTATTGTATCACGTAAACCCTG
  Flowering      
TrVP1 Clover orthologue of AVP1 5 8-2 8 [49] ACTGAATACTATACCAGCAATGC TGCAGGAGTCTGCAACATCTTGC
  Drought tolerance      
TrPPD PEAPOD 2 1-1 1-2 no hit [50] GATATCGTGAAAAGCGAAAGGAC AGCTTCACTGGAAGGTTCAAATA
  Leaf meristem activity      
TrANR Anthocyanidin reductase (ANR) 1 4-2 no hit [51] GAGTGCATGTTTGGTTTGCCA TGCAAAGTTCACAGGTGTAGC
  Condensed tannin      
TrSTP STAMINA PISTILLOIDIA n/i 4-1 AC235671 [52] TGGAAGGTTTTCACCCATCTATG TATCCTGCTGTTCATCCATGGAG
  Flowering      
  1. Eighteen candidate genes related to plant morphology, chemical composition, or transcription regulation were evaluated by in silico analysis. Primers were designed from T. repens genomic sequence, and length polymorphisms were assayed in 92 members of population MP2 using intron-spanning PCR for all loci except TrANR and TrSTP, which were assayed by SNP and exon size variation, respectively. Tr LG=white clover linkage group; Mt PM=Medicago truncatula genome assembly 3.0 pseudomolecule; Ref=cited reference; no hit=not found in M. truncatula databases and n/i=no intron in this gene. Note that BAC AC235671 is not incorporated into the M. truncatula assembly.