Skip to main content

Table 1 Primers used for qRT-PCR

From: Early transcriptional responses of internalization defective Brucella abortus mutants in professional phagocytes, RAW 264.7

Accession no. Gene symbol (Description) Forward primers (5′ → 3′) Reverse primers (5′ → 3′)
NM_008392.1 Irg1 (Immunoresponsive gene 1) CCTGTGCCTCGCTGCTCGAC CGTGTCGAAGCTTGGCGGGT
NM_007987.2 Fas (TNF receptor superfamily member 6) CCTGCGCCCCATGCACAGAA TCTGGGTCAGGGTGCAGTTTGT
NM_013652.2 Ccl4 (Chemokine (C-C motif) ligand 4) GCTCTGCGTGTCTGCCCTCTC TGGTGCTGAGAACCCTGGAGCA
NM_139154.2 Rab40c (Rab40c, member RAS oncogene family) GACGGCGCAGCTGAATCCCC CCAGCTTGACACGCCGTCCA
NM_028724.4 Rin2 (Ras and Rab interactor 2) TCTGCCCTGCCTCCTTGCGT GCACTCCAGCTCCGAAGGCG
NM_023635.5 Rab27a (Rab27a, member RAS oncogene family) AAAAGGCCAGTCGCACGGGG TGTCCCTGCGGTGTTGCGTC
NM_008084.2 Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) CCCCAGCAAGGACACTGAGCAAG TGGGGGTCTGGGATGGAAATTGTG