Skip to main content

Table 2 List of primers used in this study

From: A case of adaptation through a mutation in a tandem duplication during experimental evolution in Escherichia coli

Primer name Direction Genome positiona Sequence (5'-3')b Used for
IS3F1 Forward 2,057,888 CGCTGTACCGACTCATAAGT Detection of ogrK-yegSR deletion
IS3R1 Reverse 2,061,063 GATGCTGAACTCAGCCTGATG Detection of ogrK-yegSR deletion
IS3R2 Reverse 2,059,299 CATTCCTTCCTCACGCAAC Detection of ogrK-yegSR deletion
IS5F1 Forward 2,172,688 CACCATCAACTGTCTCACCA Detection of duplication
IS5R1 Reverse 1,993,645 GACCCGCAGATGATGATTAC Detection of duplication
DelF Forward 2,057,748 CACCGTAACGCTGTTTTGACCG Detection of ogrK-yegSR deletion
DelR Reverse 2,062,009 GGATCTTGAGCTCAATTACGCGC Detection of ogrK-yegSR deletion
IS3EF Forward NAc GCTGCTACGATAATGCCTGCG Inverse PCR
IS3ER Reverse NAc GCGTTCAGCAAGCTTCAGGG Inverse PCR
FrontR Forward 1,993,555 GTACATTATGCCTGTTCCGAG Detection of duplication
FrontF Reverse 2,172,636 TCGTATTATTGGCGGTCCC Detection of duplication
ogrKAmpF1 Forward 2,057,979 GGCTTGTACGCGCATGTGCGGCATGCTGGCATAAGAGTTGGTAGCTCTTGATC Strain construction
yegSAmpF2 Forward 2,058,495 CTCACTCTCCACATTTGAATGTCAGACGAGCGACAGAGTTGGTAGCTCTTGATC Strain construction
yegRAmpF3 Forward 2,059,218 CATGGCAGAATTTCCCGCCAGCTTACTGATTCTTAGAGTTGGTAGCTCTTGATC Strain construction
ogrKAmpR1 Reverse 2,058,472 GGTAAGCGTCAAATATGCGCGTTCTGGCTGTGCCATTCAAATATGTATCCGCT Strain construction
yegSAmpR2 Reverse 2,059,189 TGATTGGTCTGTAGATAGTGTAGAGCAGAAAACCATTCAAATATGTATCCGCT Strain construction
yegRAmpR3 Reverse 2,060,666 GACCGTTATTCTCGACAGCGGAAGTACGACAATGCATTCAAATATGTATCCGCT Strain construction
  1. aThe positions are given according to the genome sequence of the ancestor strain BW2952 [29]. bSequences in bold are homologous to the bla antibiotic resistance gene. cNot applicable; these primers are complementary to sequences inside the IS3 elements.