Skip to main content

Table 4 Primers used for sequencing validation of SNPs discovered between ten Brassica napus accessions

From: Identification of genome-wide single nucleotide polymorphisms in allopolyploid crop Brassica napus

Primer_Name SNP_type Locus Forward_primer Tm(°C) Reverse primer Tm(°C)
ns001 A/G BRscaffold000003-1385327 CATCAGGGAAATGGAGAGGA 60 GTGCACCAGCTCTCAAACAA 60
ns002 A/G BRscaffold000027-2243593 CGGTTTAGGATCCGAGTTGA 60 CACGTCGCTACTGCAGCTTA 60
ns003 A/G BOscaffold000050-1147091 CAGTGCTTGGCTCGTGTCTA 60 ATTCTGAATTCCGTTGACCG 60
ns004 G/T BRscaffold000039-1828478 TCTGTCGGCTCTGTCATCTG 60 TCCGGTTCAGTTTCTGGTTC 60
ns005 A/G BOscaffold000131-442418 GCTTTTGGTGTGGACATCCT 60 GAGATCCTGGGTCAACCAAA 60
ns006 G/C BOscaffold000197-783005 CGATCGTCATACTCGGACCT 60 TTCCGATTCTGCCTCCTCTA 60
ns007 G/C BOscaffold000230-556330 GCAGCTGATATTGCTGTGGA 60 TTGTTTCAATCCGCACAAAG 60
ns008 A/G BOscaffold000244-357760 CGTAACGTTTGGGCTGTTTT 60 ATGGTCGGCCATGTTTTTAG 60
ns009 C/T BOscaffold000265-92497 CACTAGCTTCGCATCAACCA 60 TGAGGTGTCATCGATAAGCG 60
ns010 C/T BRscaffold000130-113927 TGATCGGGTTGTACACATGG 60 AGGACGGCCTTCATTATTCT 58