Skip to main content


Table 3 Primer sequences for qRT-PCR analysis of expression of SSR marker–derived genes associated with defense responses and BAC clone-derived LRR receptor-like serine/threonine-protein kinases

From: Analysis of the leaf transcriptome of Musa acuminata during interaction with Mycosphaerella musicola: gene assembly, annotation and marker development

Gene / contig abbreviation KOG Gene description / BAC annotation Primer Sequence Forward/Reverse Amplicon Size (bp) PCR efficiency (%) Efficiency SD (+/−)
THAU_musa_c4_small_rep_c3564 Pathogenesis related proteins, group 5, Thaumatin CCGGTGGGACTAATTACAGG/ CAATTCGGATGTCAATGCAG 165 99 0,011
CHIT_musa_c4_small_c3092 Chitinase CACCATCTCCTGCAAGCATA/ GCAGTCATTCCTCGTTGTCA 123 96 0,008
M09A11_454_Ma4140M09A11 Putative LRR receptor-like serine/threonine-protein kinase CCAGCAACCACAACCCTAGT/ GATCTTTCAGGCCTCGTTTG 176 99 0,009
B03A51_454_Mac054B03A51 Putative LRR receptor-like serine/threonine-protein kinase ATTCCATGGCTACGGACAAT/ TTCAGGCCTCGTTTGAACTC 192 107 0,005
B03A11_454_Mac054B03A11 Putative LRR receptor-like serine/threonine-protein kinase CAGCAACCATAACCCCATTC/ AGGATCTTTCAGGCCTCGTT 168 105 0,011
  1. Differential gene expression in M. acuminata Calcutta 4 inoculated with M. musicola was analyzed in relation to non-inoculated controls.